分離済み変異体

tm1552

Allele Nametm1552
BalanceNot Required
OutCrossNot Accepted
Sequence NameF16F9.5
Gene Namemec-10
Worm BaseAllele Name tm1552
Gene Name mec-10
Sequence F16F9.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Driscoll: touch insensitive.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 30081/30082-30529/30530 (448 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(27406..27579, 27668..27743, 27791..27919, 28137..28312, 28470..28565, 28627..28787, 29053..29153, 29197..29271, 29322..29404, 29454..29546, 29822..29898, 30056..30125, 30229..30525, 30576..30658, 30864..30985, 31232..31324, 31372..31640))
Map position0.01
Balancer
Map position of balancer
Sequence of primersExtRev:TGCTTGGGCAAGCTCCAAAC,IntRev:TGGGAGGGAGCTTCATCTTA,ExtFwd:GGTCCAGCTCTCACACTGGA,IntFwd:GTAGGGTCTGCAACTAGCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rosero M, Bai J.
AFD Thermosensory Neurons Mediate Tactile-Dependent Locomotion Modulation in C. elegans.
bioRxiv 2025   
[ PubMed ID = 40060420 ] [ RRC reference ]

Inberg S, Iosilevskii Y, Calatayud-Sanchez A, Setty H, Oren-Suissa M, Krieg M, Podbilewicz B.
Sensory experience controls dendritic structure and behavior by distinct pathways involving degenerins.
Elife 2025 14  
[ PubMed ID = 39791349 ] [ RRC reference ]

Das A, Franco JA, Mulcahy B, Wang L, Chapman D, Jaisinghani C, Pruitt BL, Zhen M, Goodman MB.
C. elegans touch receptor neurons direct mechanosensory complex organization via repurposing conserved basal lamina proteins.
Curr Biol 2024 34(14) 3133-3151.e10 
[ PubMed ID = 38964319 ] [ RRC reference ]

Tee LF, Young JJ, Maruyama K, Kimura S, Suzuki R, Endo Y, Kimura KD.
Electric shock causes a fleeing-like persistent behavioral response in the nematode Caenorhabditis elegans.
Genetics 2023 225(2)  
[ PubMed ID = 37595066 ] [ RRC reference ]

Zhan X, Chen C, Niu L, Du X, Lei Y, Dan R, Wang ZW, Liu P.
Locomotion modulates olfactory learning through proprioception in C. elegans.
Nat Commun 2023 14(1) 4534 
[ PubMed ID = 37500635 ] [ RRC reference ]

Iliff AJ, Wang C, Ronan EA, Hake AE, Guo Y, Li X, Zhang X, Zheng M, Liu J, Grosh K, Duncan RK, Xu XZS.
The nematode C. elegans senses airborne sound.
Neuron 2021 109(22) 3633-3646.e7 
[ PubMed ID = 34555314 ] [ RRC reference ]

Tao L, Porto D, Li Z, Fechner S, Lee SA, Goodman MB, Xu XZS, Lu H, Shen K.
Parallel Processing of Two Mechanosensory Modalities by a Single Neuron in C. elegans.
Dev Cell 2019 51(5) 617-631.e3 
[ PubMed ID = 31735664 ] [ RRC reference ]

Gonzales DL, Zhou J, Fan B, Robinson JT.
A microfluidic-induced C. elegans sleep state.
Nat Commun 2019 10(1) 5035 
[ PubMed ID = 31695031 ] [ RRC reference ]

Sood P, Murthy K, Kumar V, Nonet ML, Menon GI, Koushika SP.
Cargo crowding at actin-rich regions along axons causes local traffic jams.
Traffic 2018 19(3) 166-181 
[ PubMed ID = 29178177 ] [ RRC reference ]

Shi S, Luke CJ, Miedel MT, Silverman GA, Kleyman TR.
Activation of the Caenorhabditis elegans Degenerin Channel by Shear Stress Requires the MEC-10 Subunit.
J Biol Chem 2016 291(27) 14012-14022 
[ PubMed ID = 27189943 ] [ RRC reference ]

Russell J, Vidal-Gadea AG, Makay A, Lanam C, Pierce-Shimomura JT.
Humidity sensation requires both mechanosensory and thermosensory pathways in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2014 111(22) 8269-74 
[ PubMed ID = 24843133 ] [ RRC reference ]

Sanders J, Nagy S, Fetterman G, Wright C, Treinin M, Biron D.
The Caenorhabditis elegans interneuron ALA is (also) a high-threshold mechanosensor.
BMC Neurosci 2013 14 156 
[ PubMed ID = 24341457 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]

Mohammadi A, Byrne Rodgers J, Kotera I, Ryu WS.
Behavioral response of Caenorhabditis elegans to localized thermal stimuli.
BMC Neurosci 2013 14 66 
[ PubMed ID = 23822173 ] [ RRC reference ]

Rabinowitch I, Chatzigeorgiou M, Schafer WR.
A gap junction circuit enhances processing of coincident mechanosensory inputs.
Curr Biol 2013 23(11) 963-7 
[ PubMed ID = 23707432 ] [ RRC reference ]

Cohen E, Yemini E, Schafer W, Feitelson DG, Treinin M.
Locomotion analysis identifies roles of mechanosensory neurons in governing locomotion dynamics of C. elegans.
J Exp Biol 2012 215(Pt 20) 3639-48 
[ PubMed ID = 22811252 ] [ RRC reference ]

Husson SJ, Costa WS, Wabnig S, Stirman JN, Watson JD, Spencer WC, Akerboom J, Looger LL, Treinin M, Miller DM 3rd, Lu H, Gottschalk A.
Optogenetic analysis of a nociceptor neuron and network reveals ion channels acting downstream of primary sensors.
Curr Biol 2012 22(9) 743-52 
[ PubMed ID = 22483941 ] [ RRC reference ]

Arnadóttir J, O'Hagan R, Chen Y, Goodman MB, Chalfie M.
The DEG/ENaC protein MEC-10 regulates the transduction channel complex in Caenorhabditis elegans touch receptor neurons.
J Neurosci 2011 31(35) 12695-704 
[ PubMed ID = 21880930 ] [ RRC reference ]

Chatzigeorgiou M, Schafer WR.
Lateral facilitation between primary mechanosensory neurons controls nose touch perception in C. elegans.
Neuron 2011 70(2) 299-309 
[ PubMed ID = 21521615 ] [ RRC reference ]

Li W, Kang L, Piggott BJ, Feng Z, Xu XZ.
The neural circuits and sensory channels mediating harsh touch sensation in Caenorhabditis elegans.
Nat Commun 2011 2 315 
[ PubMed ID = 21587232 ] [ RRC reference ]