分離済み変異体

tm1524

Allele Name

tm1524

Balance

Not Required

OutCross

Not Accepted

Sequence Name

Y47D3A.4

Gene Name

cku-70

Worm Base

Allele Name

tm1524

Gene Name

cku-70

Sequence

Y47D3A.4

Phenotype

homozygous viable. Dr. R.H. Horvitz: no increase of homologous recombination. Dr. S. Ahmed: Genetics 173, 1301-1317 (2006).

Mutation site

28096/28097-AGAATGAAGTTAATTTCAAAAGGTG-28898/28899 (802 bp deletion + 25 bp insertion)

Chromosome

III

Putative gene structure

join(18677..18898, 18952..19054, 22066..22250, 23042..23176, 25911..26044, 26209..26393, 27564..27599, 27973..28221, 28700..28869, 29419..29722, 31086..31288, 32449..32598)

Map position

6.63

Balancer

Map position of balancer

Sequence of primers

ExtRev:CCTTGGCGGTGGCCTAACTA,IntFwd:ATTCGCAACCGTCGTGATCT,ExtFwd:AAGACTCGATTCGCAACCGT,IntRev:CTTCCGATGACGTCCCCACT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Bujarrabal-Dueso A, Sendtner G, Meyer DH, Chatzinikolaou G, Stratigi K, Garinis GA, Schumacher B.
The DREAM complex functions as conserved master regulator of somatic DNA-repair capacities.
Nat Struct Mol Biol 2023 30(4) 475-488
[ PubMed ID = 36959262 ] [ RRC reference ]

Wang S, Meyer DH, Schumacher B.
Inheritance of paternal DNA damage by histone-mediated repair restriction.
Nature 2023 613(7943) 365-374
[ PubMed ID = 36544019 ] [ RRC reference ]

Trivedi S, Blazícková J, Silva N.
PARG and BRCA1-BARD1 cooperative function regulates DNA repair pathway choice during gametogenesis.
Nucleic Acids Res 2022 50(21) 12291-12308
[ PubMed ID = 36478097 ] [ RRC reference ]

Hicks T, Koury E, McCabe C, Williams C, Crahan C, Smolikove S.
R-loop-induced irreparable DNA damage evades checkpoint detection in the C. elegans germline.
Nucleic Acids Res 2022 50(14) 8041-8059
[ PubMed ID = 35871299 ] [ RRC reference ]

Velkova M, Silva N, Dello Stritto MR, Schleiffer A, Barraud P, Hartl M, Jantsch V.
Caenorhabditis elegans RMI2 functional homolog-2 (RMIF-2) and RMI1 (RMH-1) have both overlapping and distinct meiotic functions within the BTR complex.
PLoS Genet 2021 17(7) e1009663
[ PubMed ID = 34252074 ] [ RRC reference ]

Dello Stritto MR, Bauer B, Barraud P, Jantsch V.
DNA topoisomerase 3 is required for efficient germ cell quality control.
J Cell Biol 2021 220(6)
[ PubMed ID = 33798260 ] [ RRC reference ]

Suehiro Y, Yoshina S, Motohashi T, Iwata S, Dejima K, Mitani S.
Efficient collection of a large number of mutations by mutagenesis of DNA damage response defective animals.
Sci Rep 2021 11(1) 7630
[ PubMed ID = 33828169 ] [ RRC reference ]

Hefel A, Honda M, Cronin N, Harrell K, Patel P, Spies M, Smolikove S.
RPA complexes in Caenorhabditis elegans meiosis; unique roles in replication, meiotic recombination and apoptosis.
Nucleic Acids Res 2021 49(4) 2005-2026
[ PubMed ID = 33476370 ] [ RRC reference ]

Harrell K, Day M, Smolikove S.
Recruitment of MRE-11 to complex DNA damage is modulated by meiosis-specific chromosome organization.
Mutat Res 2021 822 111743
[ PubMed ID = 33975127 ] [ RRC reference ]

Fang EF, Hou Y, Lautrup S, Jensen MB, Yang B, SenGupta T, Caponio D, Khezri R, Demarest TG, Aman Y, Figueroa D, Morevati M, Lee HJ, Kato H, Kassahun H, Lee JH, Filippelli D, Okur MN, Mangerich A, Croteau DL, Maezawa Y, Lyssiotis CA, Tao J, Yokote K, Rusten TE, Mattson MP, Jasper H, Nilsen H, Bohr VA.
NAD⁺ augmentation restores mitophagy and limits accelerated aging in Werner syndrome.
Nat Commun 2019 10(1) 5284
[ PubMed ID = 31754102 ] [ RRC reference ]

Macaisne N, Kessler Z, Yanowitz JL.
Meiotic Double-Strand Break Proteins Influence Repair Pathway Utilization.
Genetics 2018 210(3) 843-856
[ PubMed ID = 30242011 ] [ RRC reference ]

Girard C, Roelens B, Zawadzki KA, Villeneuve AM.
Interdependent and separable functions of Caenorhabditis elegans MRN-C complex members couple formation and repair of meiotic DSBs.
Proc Natl Acad Sci U S A 2018 115(19) E4443-E4452
[ PubMed ID = 29686104 ] [ RRC reference ]

Lawrence KS, Tapley EC, Cruz VE, Li Q, Aung K, Hart KC, Schwartz TU, Starr DA, Engebrecht J.
LINC complexes promote homologous recombination in part through inhibition of nonhomologous end joining.
J Cell Biol 2016 215(6) 801-821
[ PubMed ID = 27956467 ] [ RRC reference ]

Nelson G, Jones T, Ortloff L, Ford J, Nuñez D, Braby L.
Bystander signaling in C. elegans: proton microbeam studies.
J Radiat Res. 2014 55 Suppl 1 i118-i119
[ PubMed ID = -1 ] [ RRC reference ]

Lemmens BB, Johnson NM, Tijsterman M.
COM-1 promotes homologous recombination during Caenorhabditis elegans meiosis by antagonizing Ku-mediated non-homologous end joining.
PLoS Genet 2013 9(2) e1003276
[ PubMed ID = 23408909 ] [ RRC reference ]

Vermezovic J, Stergiou L, Hengartner MO, d'Adda di Fagagna F.
Differential regulation of DNA damage response activation between somatic and germline cells in Caenorhabditis elegans.
Cell Death Differ 2012 19(11) 1847-55
[ PubMed ID = 22705849 ] [ RRC reference ]

Lowden MR, Meier B, Lee TW, Hall J, Ahmed S.
End joining at Caenorhabditis elegans telomeres.
Genetics 2008 180(2) 741-54
[ PubMed ID = 18780750 ] [ RRC reference ]

Clejan I, Boerckel J, Ahmed S.
Developmental modulation of nonhomologous end joining in Caenorhabditis elegans.
Genetics 2006 173(3) 1301-17
[ PubMed ID = 16702421 ] [ RRC reference ]