分離済み変異体

tm1523

Allele Nametm1523
BalanceCompleted
OutCrossNot Accepted
Sequence NameT20D3.7
Gene Namevps-26
Worm BaseAllele Name tm1523 (x1)
Gene Name vps-26
Sequence T20D3.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. H.C. Korswagen: QL and QR daughter cells, HSN migration defects, polarity of V5 division defects, similar to egl-20. Dr. G. Hermann: wild-type gut granules. Dr. K. Shen: normal synapse formation as determined by RAB-3 and CCB-1 localization to presynaptic sites in HSNL. Dr. S. Shaham: no obvious defects in glia development.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14539/14540-14941/14942 (402 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(13168..13371, 13654..14137, 14214..14370, 14721..14874, 14930..15157))
Map position4.19
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtFwd:TACCTAACGAGACCCAAGTC,IntFwd:CTCTGGGGCGGAACGTGTTT,IntRev:CTGGCCTCAGCTCTGCTATT,ExtRev:ACATCCGTCAGCACTGGCCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Xie S, Dierlam C, Smith E, Duran R, Williams A, Davis A, Mathew D, Naslavsky N, Iyer J, Caplan S.
The retromer complex regulates C. elegans development and mammalian ciliogenesis.
J Cell Sci 2022 135(10)  
[ PubMed ID = 35510502 ] [ RRC reference ]

Zhang Q, Wu X, Chen P, Liu L, Xin N, Tian Y, Dillin A.
The Mitochondrial Unfolded Protein Response Is Mediated Cell-Non-autonomously by Retromer-Dependent Wnt Signaling.
Cell 2018 174(4) 870-883.e17 
[ PubMed ID = 30057120 ] [ RRC reference ]

Beer KB, Rivas-Castillo J, Kuhn K, Fazeli G, Karmann B, Nance JF, Stigloher C, Wehman AM.
Extracellular vesicle budding is inhibited by redundant regulators of TAT-5 flippase localization and phospholipid asymmetry.
Proc Natl Acad Sci U S A 2018 115(6) E1127-E1136 
[ PubMed ID = 29367422 ] [ RRC reference ]

Bai Z, Grant BD.
A TOCA/CDC-42/PAR/WAVE functional module required for retrograde endocytic recycling.
Proc Natl Acad Sci U S A 2015 112(12) E1443-52 
[ PubMed ID = 25775511 ] [ RRC reference ]

Oikonomou G, Perens EA, Lu Y, Shaham S.
Some, but not all, retromer components promote morphogenesis of C. elegans sensory compartments.
Dev Biol 2012 362(1) 42-9 
[ PubMed ID = 22138055 ] [ RRC reference ]

Harterink M, Port F, Lorenowicz MJ, McGough IJ, Silhankova M, Betist MC, van Weering JRT, van Heesbeen RGHP, Middelkoop TC, Basler K, Cullen PJ, Korswagen HC.
A SNX3-dependent retromer pathway mediates retrograde transport of the Wnt sorting receptor Wntless and is required for Wnt secretion.
Nat Cell Biol 2011 13(8) 914-923 
[ PubMed ID = 21725319 ] [ RRC reference ]

Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z.
Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling.
Mol Biol Cell 2011 22(3) 354-74 
[ PubMed ID = 21148288 ] [ RRC reference ]

Silhankova M, Port F, Harterink M, Basler K, Korswagen HC.
Wnt signalling requires MTM-6 and MTM-9 myotubularin lipid-phosphatase function in Wnt-producing cells.
EMBO J 2010 29(24) 4094-105 
[ PubMed ID = 21076391 ] [ RRC reference ]

Chen D, Xiao H, Zhang K, Wang B, Gao Z, Jian Y, Qi X, Sun J, Miao L, Yang C.
Retromer is required for apoptotic cell clearance by phagocytic receptor recycling.
Science 2010 327(5970) 1261-4 
[ PubMed ID = 20133524 ] [ RRC reference ]

Coudreuse DY, Roël G, Betist MC, Destrée O, Korswagen HC.
Wnt gradient formation requires retromer function in Wnt-producing cells.
Science 2006 312(5775) 921-4 
[ PubMed ID = 16645052 ] [ RRC reference ]

Prasad BC, Clark SG.
Wnt signaling establishes anteroposterior neuronal polarity and requires retromer in C. elegans.
Development 2006 133(9) 1757-66 
[ PubMed ID = 16571624 ] [ RRC reference ]