分離済み変異体

tm1516

Allele Nametm1516
BalanceNot Required
OutCrossNot Accepted
Sequence NameF40G9.11
Gene Namemxl-2
Worm BaseAllele Name tm1516
Gene Name mxl-2
Sequence F40G9.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. B. Conradt: slow growth at 15?C.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 25942/25943-26627/26628 (685 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(25714..25887, 25942..26107, 26486..26571, 26625..26816))
Map position-26.93
Balancer
Map position of balancer
Sequence of primersIntRev:GCTATGTTCGACATGGTCTG ,IntFwd:AGACTACAGAGAAGGCCAGA,ExtRev:GACACACAATTCGCGGCGTT,ExtFwd:CCACGCGATTTCAACCATTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cornwell AB, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
Geroscience 2024 46(5) 4827-4854 
[ PubMed ID = 38878153 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Cornwell A, Zhang Y, Thondamal M, Johnson DW, Thakar J, Samuelson AV.
The C. elegans Myc-family of transcription factors coordinate a dynamic adaptive response to dietary restriction.
bioRxiv 2023   
[ PubMed ID = 38045350 ] [ RRC reference ]

Lazaro-Pena MI, Cornwell AB, Diaz-Balzac CA, Das R, Ward ZC, Macoretta N, Thakar J, Samuelson AV.
Homeodomain-interacting protein kinase maintains neuronal homeostasis during normal Caenorhabditis elegans aging and systemically regulates longevity from serotonergic and GABAergic neurons.
Elife 2023 12  
[ PubMed ID = 37338980 ] [ RRC reference ]

Matty MA, Lau HE, Haley JA, Singh A, Chakraborty A, Kono K, Reddy KC, Hansen M, Chalasani SH.
Intestine-to-neuronal signaling alters risk-taking behaviors in food-deprived Caenorhabditis elegans.
PLoS Genet 2022 18(5) e1010178 
[ PubMed ID = 35511794 ] [ RRC reference ]

Denzel MS, Lapierre LR, Mack HID.
Emerging topics in C. elegans aging research: Transcriptional regulation, stress response and epigenetics.
Mech Ageing Dev 2019 177 4-21 
[ PubMed ID = 30134144 ] [ RRC reference ]

Opperman KJ, Mulcahy B, Giles AC, Risley MG, Birnbaum RL, Tulgren ED, Dawson-Scully K, Zhen M, Grill B.
The HECT Family Ubiquitin Ligase EEL-1 Regulates Neuronal Function and Development.
Cell Rep 2017 19(4) 822-835 
[ PubMed ID = 28445732 ] [ RRC reference ]

Botts MR, Cohen LB, Probert CS, Wu F, Troemel ER.
Microsporidia Intracellular Development Relies on Myc Interaction Network Transcription Factors in the Host.
G3 (Bethesda) 2016 6(9) 2707-16 
[ PubMed ID = 27402359 ] [ RRC reference ]

Nakamura S, Karalay Ö, Jäger PS, Horikawa M, Klein C, Nakamura K, Latza C, Templer SE, Dieterich C, Antebi A.
Mondo complexes regulate TFEB via TOR inhibition to promote longevity in response to gonadal signals.
Nat Commun 2016 7 10944 
[ PubMed ID = 27001890 ] [ RRC reference ]

Johnson DW, Llop JR, Farrell SF, Yuan J, Stolzenburg LR, Samuelson AV.
The Caenorhabditis elegans Myc-Mondo/Mad complexes integrate diverse longevity signals.
PLoS Genet 2014 10(4) e1004278 
[ PubMed ID = 24699255 ] [ RRC reference ]

Pickett CL, Breen KT, Ayer DE.
A C. elegans Myc-like network cooperates with semaphorin and Wnt signaling pathways to control cell migration.
Dev Biol 2007 310(2) 226-39 
[ PubMed ID = 17826759 ] [ RRC reference ]