| Allele Name | tm1512 |
| Allele Type | 通常株 |
| Sequence Name | Y39A1A.5 |
| Gene Name | rabx-5 |
| Worm Base | Allele Name |
tm1512
|
| Gene Name |
rabx-5
|
| Sequence |
Y39A1A.5
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. Y. Jin: normal behavior. Dr. B. Grant: Nature Cell Biol. 7, 559-569 (2005). |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 8810/8811-9793/9794 (983 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(8497..8559, 9470..9553, 9733..9848, 10170..10270, 10365..10416, 14130..14677, 15303..15440, 15752..16004, 16352..16433, 16754..16954) |
| Map position | 3.91 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:GCGCGGCAGATGTTCTGTGT,IntFwd:ATTCCCCCAGATTGTGTATG,ExtRev:CCGGTGACGTGGAAGTTGGT,IntRev:TTGGTGAACTGGTTCCGCCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Sann SB, Crane MM, Lu H, Jin Y.
Rabx-5 regulates RAB-5 early endosomal compartments and synaptic vesicles in C. elegans.
PLoS One 2012 7(6) e37930
[ PubMed ID = 22675499 ]
[ RRC reference ]
|
Dwivedi M, Sung H, Shen H, Park BJ, Lee S.
Disruption of endocytic pathway regulatory genes activates autophagy in C. elegans.
Mol Cells 2011 31(5) 477-81
[ PubMed ID = 21618079 ]
[ RRC reference ]
|
Audhya A, Desai A, Oegema K.
A role for Rab5 in structuring the endoplasmic reticulum.
J Cell Biol 2007 178(1) 43-56
[ PubMed ID = 17591921 ]
[ RRC reference ]
|
Sato M, Sato K, Fonarev P, Huang CJ, Liou W, Grant BD.
Caenorhabditis elegans RME-6 is a novel regulator of RAB-5 at the clathrin-coated pit.
Nat Cell Biol 2005 7(6) 559-69
[ PubMed ID = 15895077 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.