分離済み変異体

tm1504

Allele Nametm1504
Allele Type通常株
Sequence NameZC412.1
Gene Namenpr-13
Worm BaseAllele Name tm1504
Gene Name npr-13
Sequence ZC412.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. L. Avery: feeding and satiety behavior normal.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13289/13290-14393/14394 (1104 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(8455..8706, 9249..9339, 9485..9634, 10167..10321, 11100..11348, 11541..11594, 11637..11765, 1815..11922, 12604..12701, 13203..13311, 13421..13558, 14093..14179))
Map position6.97
Balancer
Map position of balancer
Sequence of primersIntFwd:CAGACCATGGTTCCCGGAGT,ExtFwd:CCCTTGCATGCCTATCAGAC,IntRev:TGAACGCCCATCTAAACCAG,ExtRev:GTCTGTGTGGTCCACCATAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chai CM, Park H, Sternberg PW.
Brain-wide bidirectional neuropeptide modulation of individual neuron classes regulates a developmental decision.
Curr Biol 2022 32(15) 3365-3373.e6 
[ PubMed ID = 35679871 ] [ RRC reference ]

Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR.
An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans.
Neuron 2018 99(6) 1233-1246.e6 
[ PubMed ID = 30146306 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J Neurosci 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]

Cohen M, Reale V, Olofsson B, Knights A, Evans P, de Bono M.
Coordinated regulation of foraging and metabolism in C. elegans by RFamide neuropeptide signaling.
Cell Metab 2009 9(4) 375-85 
[ PubMed ID = 19356718 ] [ RRC reference ]