Allele Name | tm1504 |
Allele Type | 通常株 |
Sequence Name | ZC412.1 |
Gene Name | npr-13 |
Worm Base | Allele Name |
tm1504
|
Gene Name |
npr-13
|
Sequence |
ZC412.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. L. Avery: feeding and satiety behavior normal. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 13289/13290-14393/14394 (1104 bp deletion) |
Chromosome | V |
Putative gene structure | complement(join(8455..8706, 9249..9339, 9485..9634, 10167..10321, 11100..11348, 11541..11594, 11637..11765, 1815..11922, 12604..12701, 13203..13311, 13421..13558, 14093..14179)) |
Map position | 6.97 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:CAGACCATGGTTCCCGGAGT,ExtFwd:CCCTTGCATGCCTATCAGAC,IntRev:TGAACGCCCATCTAAACCAG,ExtRev:GTCTGTGTGGTCCACCATAA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Chai CM, Park H, Sternberg PW. Brain-wide bidirectional neuropeptide modulation of individual neuron classes regulates a developmental decision. Curr Biol 2022 32(15) 3365-3373.e6
[ PubMed ID = 35679871 ]
[ RRC reference ]
|
Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR. An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans. Neuron 2018 99(6) 1233-1246.e6
[ PubMed ID = 30146306 ]
[ RRC reference ]
|
Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR. A database of Caenorhabditis elegans behavioral phenotypes. Nat Methods 2013 10(9) 877-9
[ PubMed ID = 23852451 ]
[ RRC reference ]
|
Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R. Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans. J Neurosci 2013 33(35) 14107-16
[ PubMed ID = 23986246 ]
[ RRC reference ]
|
Cohen M, Reale V, Olofsson B, Knights A, Evans P, de Bono M. Coordinated regulation of foraging and metabolism in C. elegans by RFamide neuropeptide signaling. Cell Metab 2009 9(4) 375-85
[ PubMed ID = 19356718 ]
[ RRC reference ]
|
|