| Allele Name | tm1503 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F08C6.4 |
| Gene Name | sto-1 |
| Worm Base | Allele Name |
tm1503
|
| Gene Name |
sto-1
|
| Sequence |
F08C6.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. P. Sengupta: Dyf+ in all sensory neurons. Dr. K. Shen: normal synapse formation as determined by VAMP::YFP localization to presynaptic sites in HSNL. Dr. M. Chalfie: non-Mec. Dr. C. Hunter: normal growth and developement at 20C. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 4891/4892-5474/5475 (583 bp deletion) |
| Chromosome | X |
| Putative gene structure | join(4947..5040, 5346..5446, 5494..5646, 5698..5772, 5819..6082, 6156..6274, 6323..6509) |
| Map position | -1.58 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:GGTGGCTGGAACTGTATCCT,IntRev:ATGGATTGAAGGGCGGCATT,ExtFwd:TCACACCGTCCGGTACTCTC,IntFwd:GTCCGGTACTCTCTGTATAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Okahata M, Sawada N, Nakao K, Ohta A, Kuhara A.
Screening for cold tolerance genes in C. elegans, whose expressions are affected by anticancer drugs camptothecin and leptomycin B.
Sci Rep 2024 14(1) 5401
[ PubMed ID = 38443452 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.