分離済み変異体

tm1502

Allele Nametm1502
BalanceCompleted
OutCrossNot Accepted
Sequence NameDY3.2
Gene Namelmn-1
Worm BaseAllele Name tm1502 (x1)
Gene Name lmn-1
Sequence DY3.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" sterile. Dr. J. Liu & Dr. Y. Gruenbaum: Proc Natl Acad Sci U S A102, 16690-16695 (2005)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4675/4676-5280/5281 (605 bp deletion)
ChromosomeI
Putative gene structurejoin(4728..4825, 4915..4999, 5048..5161, 5317..5550, 5603..6643, 6728..6856)
Map position3.07
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersIntRev:GCATGTGGAGCGAGCTTCAT,ExtRev:GCATCCGCAGACCAAACGGT,IntFwd:TGGCGCCTATGACGTTTCCT,ExtFwd:TCACGTTCGTGTGGCGCCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Breusegem SY, Houghton J, Romero-Bueno R, Fragoso-Luna A, Kentistou KA, Ong KK, Janssen AFJ, Bright NA, Riedel CG, Perry JRB, Askjaer P, Larrieu D.
A multiparametric anti-aging CRISPR screen uncovers a role for BAF in protein synthesis regulation.
Nat Commun 2025 16(1) 1681 
[ PubMed ID = 39956852 ] [ RRC reference ]

Gregory EF, Kalra S, Brock T, Bonne G, Luxton GWG, Hopkins C, Starr DA.
Caenorhabditis elegans models for striated muscle disorders caused by missense variants of human LMNA.
PLoS Genet 2023 19(8) e1010895 
[ PubMed ID = 37624850 ] [ RRC reference ]

Velez-Aguilera G, Ossareh-Nazari B, Van Hove L, Joly N, Pintard L.
Cortical microtubule pulling forces contribute to the union of the parental genomes in the Caenorhabditis elegans zygote.
Elife 2022 11  
[ PubMed ID = 35259092 ] [ RRC reference ]

Shankar R, Lettman MM, Whisler W, Frankel EB, Audhya A.
The ESCRT machinery directs quality control over inner nuclear membrane architecture.
Cell Rep 2022 38(3) 110263 
[ PubMed ID = 35045304 ] [ RRC reference ]

Huelgas-Morales G, Sanders M, Mekonnen G, Tsukamoto T, Greenstein D.
Decreased mechanotransduction prevents nuclear collapse in a Caenorhabditis elegans laminopathy.
Proc Natl Acad Sci U S A 2020 117(49) 31301-31308 
[ PubMed ID = 33229589 ] [ RRC reference ]

Velez-Aguilera G, Nkombo Nkoula S, Ossareh-Nazari B, Link J, Paouneskou D, Van Hove L, Joly N, Tavernier N, Verbavatz JM, Jantsch V, Pintard L.
PLK-1 promotes the merger of the parental genome into a single nucleus by triggering lamina disassembly.
Elife 2020 9  
[ PubMed ID = 33030429 ] [ RRC reference ]

Link J, Paouneskou D, Velkova M, Daryabeigi A, Laos T, Labella S, Barroso C, Pacheco Piñol S, Montoya A, Kramer H, Woglar A, Baudrimont A, Markert SM, Stigloher C, Martinez-Perez E, Dammermann A, Alsheimer M, Zetka M, Jantsch V.
Transient and Partial Nuclear Lamina Disruption Promotes Chromosome Movement in Early Meiotic Prophase.
Dev Cell 2018 45(2) 212-225.e7 
[ PubMed ID = 29689196 ] [ RRC reference ]

Penfield L, Wysolmerski B, Mauro M, Farhadifar R, Martinez MA, Biggs R, Wu HY, Broberg C, Needleman D, Bahmanyar S.
Dynein pulling forces counteract lamin-mediated nuclear stability during nuclear envelope repair.
Mol Biol Cell 2018 29(7) 852-868 
[ PubMed ID = 29386297 ] [ RRC reference ]

Lyakhovetsky R, Gruenbaum Y.
Studying lamins in invertebrate models.
Adv Exp Med Biol 2014 773 245-62 
[ PubMed ID = 24563351 ] [ RRC reference ]

Mattout A, Pike BL, Towbin BD, Bank EM, Gonzalez-Sandoval A, Stadler MB, Meister P, Gruenbaum Y, Gasser SM.
An EDMD mutation in C. elegans lamin blocks muscle-specific gene relocation and compromises muscle integrity.
Curr Biol 2011 21(19) 1603-14 
[ PubMed ID = 21962710 ] [ RRC reference ]

Pan CL, Peng CY, Chen CH, McIntire S.
Genetic analysis of age-dependent defects of the Caenorhabditis elegans touch receptor neurons.
Proc Natl Acad Sci U S A 2011 108(22) 9274-9 
[ PubMed ID = 21571636 ] [ RRC reference ]

Bar DZ, Neufeld E, Feinstein N, Gruenbaum Y.
Gliotoxin reverses age-dependent nuclear morphology phenotypes, ameliorates motility, but fails to affect lifespan of adult Caenorhabditis elegans.
Cell Motil Cytoskeleton 2009 66(10) 791-7 
[ PubMed ID = 19235201 ] [ RRC reference ]

Haithcock E, Dayani Y, Neufeld E, Zahand AJ, Feinstein N, Mattout A, Gruenbaum Y, Liu J.
Age-related changes of nuclear architecture in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2005 102(46) 16690-5 
[ PubMed ID = 16269543 ] [ RRC reference ]