分離済み変異体

tm1498

Allele Name

tm1498

Balance

Not Required

OutCross

Not Accepted

Sequence Name

T22D1.12

Gene Name

npr-12

Worm Base

Allele Name

tm1498

Gene Name

npr-12

Sequence

T22D1.12

Phenotype

homozygous viable. Dr. L. Avery: feeding and satiety behavior normal.

Mutation site

38843/38844-C-39448/39449 (605 bp deletion + 1 bp insertion)

Chromosome

Putative gene structure

complement(join(38266..38322, 38420..38518, 38614..38713, 38769..39118, 39530..39769, 39921..40175, 40222..40296))

Map position

3.25

Balancer

Map position of balancer

Sequence of primers

IntRev:GTATGCAACCGCCAAACTCT,ExtRev:ACCCCCTTTGGCAGTTTATG,IntFwd:TCGGTGGCACCCGAGAAATA,ExtFwd:CGTTGAGAAATCGGTGGCAC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Dong B, Chen W.
A high precision method of segmenting complex postures in Caenorhabditis elegans and deep phenotyping to analyze lifespan.
Sci Rep 2025 15(1) 8870
[ PubMed ID = 40087519 ] [ RRC reference ]

Otarigho B, Butts AF, Aballay A.
Neuronal NPR-15 modulates molecular and behavioral immune responses via the amphid sensory neuron-intestinal axis in C. elegans.
Elife 2024 12
[ PubMed ID = 38446031 ] [ RRC reference ]

Cockx B, Van Bael S, Boelen R, Vandewyer E, Yang H, Le TA, Dalzell JJ, Beets I, Ludwig C, Lee J, Temmerman L.
Mass Spectrometry-Driven Discovery of Neuropeptides Mediating Nictation Behavior of Nematodes.
Mol Cell Proteomics 2023 22(2) 100479
[ PubMed ID = 36481452 ] [ RRC reference ]

Chai CM, Park H, Sternberg PW.
Brain-wide bidirectional neuropeptide modulation of individual neuron classes regulates a developmental decision.
Curr Biol 2022 32(15) 3365-3373.e6
[ PubMed ID = 35679871 ] [ RRC reference ]

Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR.
An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans.
Neuron 2018 99(6) 1233-1246.e6
[ PubMed ID = 30146306 ] [ RRC reference ]

E L, Zhou T, Koh S, Chuang M, Sharma R, Pujol N, Chisholm AD, Eroglu C, Matsunami H, Yan D.
An Antimicrobial Peptide and Its Neuronal Receptor Regulate Dendrite Degeneration in Aging and Infection.
Neuron 2018 97(1) 125-138.e5
[ PubMed ID = 29301098 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9
[ PubMed ID = 23852451 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J Neurosci 2013 33(35) 14107-16
[ PubMed ID = 23986246 ] [ RRC reference ]

Cohen M, Reale V, Olofsson B, Knights A, Evans P, de Bono M.
Coordinated regulation of foraging and metabolism in C. elegans by RFamide neuropeptide signaling.
Cell Metab 2009 9(4) 375-85
[ PubMed ID = 19356718 ] [ RRC reference ]