| Allele Name | tm1473 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | T01B10.4a |
| Gene Name | nhr-14 |
| Worm Base | Allele Name |
tm1473
|
| Gene Name |
nhr-14
|
| Sequence |
T01B10.4a
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. S.S. Lee: no developmental or lifespan phenotype. Dr. X. Wang: normal apoptosis. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 6666/6667-7075/7076 (409 bp deletion) |
| Chromosome | X |
| Putative gene structure | complement(join(5772..5822, 5877..6072, 6123..6610, 6996..7196, 7251..7482, 7552..7691)) |
| Map position | 0.01 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:TAGGGTTACTGTAACGCGAG,ExtRev:AGGCATCTCGTGTGTAGTGT,ExtFwd:CTCGAGAGGTGGAGTCTCAC,IntRev:CGGCAATGGAAGAGACCCCT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Sang L, Dong R, Liu R, Hao Q, Bai W, Sun J. Caenorhabditis elegans NHR-14/HNF4α regulates DNA damage-induced apoptosis through cooperating with cep-1/p53. Cell Commun Signal 2022 20(1) 135
[ PubMed ID = 36050770 ]
[ RRC reference ]
|
Rajan M, Anderson CP, Rindler PM, Romney SJ, Ferreira Dos Santos MC, Gertz J, Leibold EA. NHR-14 loss of function couples intestinal iron uptake with innate immunity in C. elegans through PQM-1 signaling. Elife 2019 8
[ PubMed ID = 31532389 ]
[ RRC reference ]
|
Jeong J, Kim H, Choi J. In Silico Molecular Docking and In Vivo Validation with Caenorhabditis elegans to Discover Molecular Initiating Events in Adverse Outcome Pathway Framework: Case Study on Endocrine-Disrupting Chemicals with Estrogen and Androgen Receptors. Int J Mol Sci 2019 20(5)
[ PubMed ID = 30857347 ]
[ RRC reference ]
|
Sugi T, Nishida Y, Mori I. Regulation of behavioral plasticity by systemic temperature signaling in Caenorhabditis elegans. Nat Neurosci 2011 14(8) 984-92
[ PubMed ID = 21706021 ]
[ RRC reference ]
|
Allard P, Colaiácovo MP. Bisphenol A impairs the double-strand break repair machinery in the germline and causes chromosome abnormalities. Proc Natl Acad Sci U S A 2010 107(47) 20405-10
[ PubMed ID = 21059909 ]
[ RRC reference ]
|
Mimoto A, Fujii M, Usami M, Shimamura M, Hirabayashi N, Kaneko T, Sasagawa N, Ishiura S. Identification of an estrogenic hormone receptor in Caenorhabditis elegans. Biochem Biophys Res Commun 2007 364(4) 883-8
[ PubMed ID = 17963693 ]
[ RRC reference ]
|
|