| Allele Name | tm1463 |
| Allele Type | バランス済 |
| Sequence Name | F54D1.5 |
| Gene Name | gtl-2 |
| Worm Base | Allele Name |
tm1463
|
| Gene Name |
gtl-2
|
| Sequence |
F54D1.5
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile. Dr. Lihsia Chen: slow growing and sluggish, slightly Egl and constipated. Dr. Y. Jin: normal aldicarb sensitivity. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 14788/14789-15251/15252 (463 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(13600..13640, 13693..14154, 14550..14763, 14819..15081, 15133..15222, 15269..15485, 15749..15871, 15926..16012, 16058..16246, 16296..16513, 16556..16636, 16678..16839, 17121..17685, 17735..17923, 18923..19281, 19326..19397, 19445..19523, 19683..19728, 19781..19904, 19966..20023, 20077..20157, 20201..20271, 20323..20437, 20483..20571, 20617..20713) |
| Map position | 4.94 |
| Balancer | nT1 [qIs51] |
| Map position of balancer | |
| Sequence of primers | ExtFwd:AACACGCGGGTACACTAGCT,IntFwd:GTCCTAGGTTGAAGTGCCGT,ExtRev:CTGCTCATCAGGCGGCAAGT,IntRev:TCATCAGGCGGCAAGTTCTG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Filipowicz A, Lalsiamthara J, Aballay A.
TRPM channels mediate learned pathogen avoidance following intestinal distention.
Elife 2021 10
[ PubMed ID = 34032213 ]
[ RRC reference ]
|
Teramoto T, Sternick LA, Kage-Nakadai E, Sajjadi S, Siembida J, Mitani S, Iwasaki K, Lambie EJ.
Magnesium excretion in C. elegans requires the activity of the GTL-2 TRPM channel.
PLoS One 2010 5(3) e9589
[ PubMed ID = 20221407 ]
[ RRC reference ]
|
Xu S, Chisholm AD.
A Gαq-Ca²⁺ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans.
Curr Biol 2011 21(23) 1960-7
[ PubMed ID = 22100061 ]
[ RRC reference ]
|
Stawicki TM, Zhou K, Yochem J, Chen L, Jin Y.
TRPM channels modulate epileptic-like convulsions via systemic ion homeostasis.
Curr Biol 2011 21(10) 883-8
[ PubMed ID = 21549603 ]
[ RRC reference ]
|
Saur T, DeMarco SE, Ortiz A, Sliwoski GR, Hao L, Wang X, Cohen BM, Buttner EA.
A genome-wide RNAi screen in Caenorhabditis elegans identifies the nicotinic acetylcholine receptor subunit ACR-7 as an antipsychotic drug target.
PLoS Genet 2013 9(2) e1003313
[ PubMed ID = 23468647 ]
[ RRC reference ]
|
Wang X, Piccolo CW, Cohen BM, Buttner EA.
Transient receptor potential melastatin (TRPM) channels mediate clozapine-induced phenotypes in Caenorhabditis elegans.
J Neurogenet 2014 28(1-2) 86-97
[ PubMed ID = 24564792 ]
[ RRC reference ]
|
Xu S, Chisholm AD.
C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair.
Dev Cell 2014 31(1) 48-60
[ PubMed ID = 25313960 ]
[ RRC reference ]
|
Opperman K, Moseley-Alldredge M, Yochem J, Bell L, Kanayinkal T, Chen L.
A novel nondevelopmental role of the sax-7/L1CAM cell adhesion molecule in synaptic regulation in Caenorhabditis elegans.
Genetics 2015 199(2) 497-509
[ PubMed ID = 25488979 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.