分離済み変異体

tm1458

Allele Nametm1458
BalanceNot Required
OutCrossNot Accepted
Sequence NameF10B5.5
Gene Namepch-2
Worm BaseAllele Name tm1458
Gene Name pch-2
Sequence F10B5.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. A. Dernburg: Science 310, 1683-1686 (2005). Dr. A. Gartner: Curr.Biol. 16, R249-R251 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19276/19277-AAAAGCCGAAAAA-19788/19789 (512 bp deletion + 13 bp insertion)
ChromosomeII
Putative gene structurejoin(19234..19295, 19349..19470, 19519..20093, 20147..20467, 20514..20708)
Map position0.72
Balancer
Map position of balancer
Sequence of primersExtFwd:AACTTGGGAAGACCGCACAG,IntRev:GCCAGATAACGATGCAGGAA,ExtRev:GCACAAGAGCCAGATAACGA,IntFwd:AGCGTACAGCTCTTCAGATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Patel B, Grobler M, Herrera A, Logari E, Ortiz V, Bhalla N.
The conserved ATPase PCH-2 controls the number and distribution of crossovers by antagonizing their formation in Caenorhabditis elegans.
Elife 2025 13  
[ PubMed ID = 39964851 ] [ RRC reference ]

Zhang R, Liu B, Tian Y, Xin M, Li Q, Huang X, Liu Y, Zhao L, Qi F, Wang R, Meng X, Chen J, Zhou J, Gao J.
A chromosome-coupled ubiquitin-proteasome pathway is required for meiotic surveillance.
Cell Death Differ 2024 31(12) 1730-1745 
[ PubMed ID = 39237708 ] [ RRC reference ]

Liu C, Dernburg AF.
Chemically induced proximity reveals a Piezo-dependent meiotic checkpoint at the oocyte nuclear envelope.
Science 2024 386(6724) eadm7969 
[ PubMed ID = 39571011 ] [ RRC reference ]

Laranjeira AC, Berger S, Kohlbrenner T, Greter NR, Hajnal A.
Nutritional vitamin B12 regulates RAS/MAPK-mediated cell fate decisions through one-carbon metabolism.
Nat Commun 2024 15(1) 8178 
[ PubMed ID = 39289374 ] [ RRC reference ]

Kohlbrenner T, Berger S, Laranjeira AC, Aegerter-Wilmsen T, Comi LF, deMello A, Hajnal A.
Actomyosin-mediated apical constriction promotes physiological germ cell death in C. elegans.
PLoS Biol 2024 22(8) e3002775 
[ PubMed ID = 39178318 ] [ RRC reference ]

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Russo AE, Giacopazzi S, Deshong A, Menon M, Ortiz V, Ego KM, Corbett KD, Bhalla N.
The conserved AAA ATPase PCH-2 distributes its regulation of meiotic prophase events through multiple meiotic HORMADs in C. elegans.
PLoS Genet 2023 19(4) e1010708 
[ PubMed ID = 37058535 ] [ RRC reference ]

Patel B, Grobler M, Bhalla N.
Chromosomal fusions, but not chromosomal inversions, activate a PCH-2 dependent checkpoint that promotes crossover formation in C. elegans.
MicroPubl Biol 2023 2023  
[ PubMed ID = 37408786 ] [ RRC reference ]

Aprison EZ, Dzitoyeva S, Angeles-Albores D, Ruvinsky I.
A male pheromone that improves the quality of the oogenic germline.
Proc Natl Acad Sci U S A 2022 119(21) e2015576119 
[ PubMed ID = 35576466 ] [ RRC reference ]

Lascarez-Lagunas LI, Herruzo E, Grishok A, San-Segundo PA, Colaiácovo MP.
DOT-1.1-dependent H3K79 methylation promotes normal meiotic progression and meiotic checkpoint function in C. elegans.
PLoS Genet 2020 16(10) e1009171 
[ PubMed ID = 33104701 ] [ RRC reference ]

Défachelles L, Russo AE, Nelson CR, Bhalla N.
The conserved AAA-ATPase PCH-2 TRIP13 regulates spindle checkpoint strength.
Mol Biol Cell 2020 31(20) 2219-2233 
[ PubMed ID = 32697629 ] [ RRC reference ]

Raiders SA, Eastwood MD, Bacher M, Priess JR.
Binucleate germ cells in Caenorhabditis elegans are removed by physiological apoptosis.
PLoS Genet 2018 14(7) e1007417 
[ PubMed ID = 30024879 ] [ RRC reference ]

Turcotte CA, Sloat SA, Rigothi JA, Rosenkranse E, Northrup AL, Andrews NP, Checchi PM.
Maintenance of Genome Integrity by Mi2 Homologs CHD-3 and LET-418 in Caenorhabditis elegans.
Genetics 2018 208(3) 991-1007 
[ PubMed ID = 29339410 ] [ RRC reference ]

McManus CE, Reinke V.
The Germline-Specific Factor OEF-1 Facilitates Coordinated Progression Through Germ Cell Development in Caenorhabditis elegans.
Genetics 2018 208(2) 549-563 
[ PubMed ID = 29167199 ] [ RRC reference ]

Bohr T, Ashley G, Eggleston E, Firestone K, Bhalla N.
Synaptonemal Complex Components Are Required for Meiotic Checkpoint Function in Caenorhabditis elegans.
Genetics 2016 204(3) 987-997 
[ PubMed ID = 27605049 ] [ RRC reference ]

Nelson CR, Hwang T, Chen PH, Bhalla N.
TRIP13PCH-2 promotes Mad2 localization to unattached kinetochores in the spindle checkpoint response.
J Cell Biol 2015 211(3) 503-16 
[ PubMed ID = 26527744 ] [ RRC reference ]

Bohr T, Nelson CR, Klee E, Bhalla N.
Spindle assembly checkpoint proteins regulate and monitor meiotic synapsis in C. elegans.
J Cell Biol 2015 211(2) 233-42 
[ PubMed ID = 26483555 ] [ RRC reference ]

Mei F, Chen PF, Dombecki CR, Aljabban I, Nabeshima K.
A Defective Meiotic Outcome of a Failure in Homologous Pairing and Synapsis Is Masked by Meiotic Quality Control.
PLoS One 2015 10(8) e0134871 
[ PubMed ID = 26247362 ] [ RRC reference ]