| Allele Name | tm1453 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | T05F1.1 |
| Gene Name | dhs-4 |
| Worm Base | Allele Name |
tm1453
|
| Gene Name |
dhs-4
|
| Sequence |
T05F1.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 1096/1097-TTGATAAA-1530/1531 (434 bp deletion + 8 bp insertion) |
| Chromosome | I |
| Putative gene structure | join(64..141, 187..338, 386..512, 571..1114, 1166..1289, 1339..1921, 1971..2036) |
| Map position | 3.83 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GCGAGTGGGTAGCAATCTGT,ExtRev:CCCTCGATAGTGTTCTGCGA,IntFwd:GAGTTTCATGCGTACCGTCT,ExtFwd:TTTAGGTGAACGGGTCCCAG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Richard M, Boulin T, Robert VJ, Richmond JE, Bessereau JL.
Biosynthesis of ionotropic acetylcholine receptors requires the evolutionarily conserved ER membrane complex.
Proc Natl Acad Sci U S A 2013 110(11) E1055-63
[ PubMed ID = 23431131 ]
[ RRC reference ]
|
Almedom RB, Liewald JF, Hernando G, Schultheis C, Rayes D, Pan J, Schedletzky T, Hutter H, Bouzat C, Gottschalk A.
An ER-resident membrane protein complex regulates nicotinic acetylcholine receptor subunit composition at the synapse.
EMBO J 2009 28(17) 2636-49
[ PubMed ID = 19609303 ]
[ RRC reference ]
|
Gottschalk A, Almedom RB, Schedletzky T, Anderson SD, Yates JR 3rd, Schafer WR.
Identification and characterization of novel nicotinic receptor-associated proteins in Caenorhabditis elegans.
EMBO J 2005 24(14) 2566-78
[ PubMed ID = 15990870 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.