分離済み変異体

tm1452

Allele Name

tm1452

Balance

Not Required

OutCross

Not Accepted

Sequence Name

ZK1127.9

Gene Name

tcer-1

Worm Base

Allele Name

tm1452

Gene Name

tcer-1

Sequence

ZK1127.9

Phenotype

homozygous viable. Dr. C. Kenyon: reduced progeny and slightly delayed development. Dr. G. Ruvkun: non-Rde for pos-1 and unc-22 RNAi.

Mutation site

15222/15223-AAAATTAAAA-15614/15615 (392 bp deletion + 10 bp insertion)

Chromosome

Putative gene structure

complement(join(11971..12038, 12093..12324, 12373..12819, 12874..14213, 14732..14918, 15414..15756, 15901..16001))

Map position

0.35

Balancer

Map position of balancer

Sequence of primers

IntRev:GTGTCCATCAGTCAAGACGA,ExtRev:ACCGACCTCTGATTCCTGGT,IntFwd:GCCAATTCTGGTTGAGTGAC,ExtFwd:CCTCTTCCGTGGCTCTATGA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Bahr L, Amrit FRG, Silvia PE, Wayhs B, Osman GA, Devare MN, Henry H, Bui D, Choe M, Naim N, Champion M, Man Y, Olsen CP, Ghazi A.
LIPL-1 and LIPL-2 are TCER-1-regulated lysosomal lipases with distinct roles in immunity and fertility.
PLoS Genet 2025 21(12) e1011804
[ PubMed ID = 41385585 ] [ RRC reference ]

He B, Xu J, Pang S, Tang H.
Phosphatidylcholine mediates the crosstalk between LET-607 and DAF-16 stress response pathways.
PLoS Genet 2021 17(5) e1009573
[ PubMed ID = 34014977 ] [ RRC reference ]

Pérez-Jiménez MM, Monje-Moreno JM, Brokate-Llanos AM, Venegas-Calerón M, Sánchez-García A, Sansigre P, Valladares A, Esteban-García S, Suárez-Pereira I, Vitorica J, Ríos JJ, Artal-Sanz M, Carrión ÁM, Muñoz MJ.
Steroid hormones sulfatase inactivation extends lifespan and ameliorates age-related diseases.
Nat Commun 2021 12(1) 49
[ PubMed ID = 33397961 ] [ RRC reference ]

Amrit FRG, Naim N, Ratnappan R, Loose J, Mason C, Steenberge L, McClendon BT, Wang G, Driscoll M, Yanowitz JL, Ghazi A.
The longevity-promoting factor, TCER-1, widely represses stress resistance and innate immunity.
Nat Commun 2019 10(1) 3042
[ PubMed ID = 31316054 ] [ RRC reference ]

Ewald CY, Marfil V, Li C.
Alzheimer-related protein APL-1 modulates lifespan through heterochronic gene regulation in Caenorhabditis elegans.
Aging Cell 2016 15(6) 1051-1062
[ PubMed ID = 27557896 ] [ RRC reference ]

Amrit FR, Steenkiste EM, Ratnappan R, Chen SW, McClendon TB, Kostka D, Yanowitz J, Olsen CP, Ghazi A.
DAF-16 and TCER-1 Facilitate Adaptation to Germline Loss by Restoring Lipid Homeostasis and Repressing Reproductive Physiology in C. elegans.
PLoS Genet 2016 12(2) e1005788
[ PubMed ID = 26862916 ] [ RRC reference ]

Steinbaugh MJ, Narasimhan SD, Robida-Stubbs S, Moronetti Mazzeo LE, Dreyfuss JM, Hourihan JM, Raghavan P, Operaña TN, Esmaillie R, Blackwell TK.
Lipid-mediated regulation of SKN-1/Nrf in response to germ cell absence.
Elife 2015 4
[ PubMed ID = 26196144 ] [ RRC reference ]

Ratnappan R, Amrit FR, Chen SW, Gill H, Holden K, Ward J, Yamamoto KR, Olsen CP, Ghazi A.
Germline signals deploy NHR-49 to modulate fatty-acid β-oxidation and desaturation in somatic tissues of C. elegans.
PLoS Genet 2014 10(12) e1004829
[ PubMed ID = 25474470 ] [ RRC reference ]

Sinha A, Rae R.
A functional genomic screen for evolutionarily conserved genes required for lifespan and immunity in germline-deficient C. elegans.
PLoS One 2014 9(8) e101970
[ PubMed ID = 25093668 ] [ RRC reference ]

Pushpa K, Kumar GA, Subramaniam K.
PUF-8 and TCER-1 are essential for normal levels of multiple mRNAs in the C. elegans germline.
Development 2013 140(6) 1312-20
[ PubMed ID = 23444359 ] [ RRC reference ]

Boulias K, Horvitz HR.
The C. elegans microRNA mir-71 acts in neurons to promote germline-mediated longevity through regulation of DAF-16/FOXO.
Cell Metab 2012 15(4) 439-50
[ PubMed ID = 22482727 ] [ RRC reference ]

Ghazi A, Henis-Korenblit S, Kenyon C.
A transcription elongation factor that links signals from the reproductive system to lifespan extension in Caenorhabditis elegans.
PLoS Genet 2009 5(9) e1000639
[ PubMed ID = 19749979 ] [ RRC reference ]