Home > 分離済み変異体 > tm1446

分離済み変異体

Allele Name		tm1446
Balance		Not Required
OutCross		Not Accepted
Sequence Name		T14F9.5
Gene Name		lin-32
Worm Base	Allele Name	tm1446
	Gene Name	lin-32
	Sequence	T14F9.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Low touch sensitivity at anterior body. Dr. D. Portman: strong ray-missing phenotype. Dr. O. Hobert: Nat. Meth.5, 869 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		24261/24262-24772/24773 (511 bp deletion)
Chromosome		X
Putative gene structure		complement(join(24191..24337, 24722..24860, 24926..25068))
Map position		-16.75
Balancer
Map position of balancer
Sequence of primers		IntRev:CGCGAGCATTCCTACTATTG,ExtFwd:TGTGTCGCCCGTTATCTTGA,IntFwd:TCTACCTACCGTAGACCCAG,ExtRev:TAGCCAATGCGCGAGCATTC
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Tekieli T, Yemini E, Nejatbakhsh A, Wang C, Varol E, Fernandez RW, Masoudi N, Paninski L, Hobert O. Visualizing the organization and differentiation of the male-specific nervous system of C. elegans. Development 2021 148(18)   [ PubMed ID = 34415309 ] [ RRC reference ] Masoudi N, Yemini E, Schnabel R, Hobert O. Piecemeal regulation of convergent neuronal lineages by bHLH transcription factors in Caenorhabditis elegans. Development 2021 148(11)   [ PubMed ID = 34100067 ] [ RRC reference ] Zhang A, Noma K, Yan D. Regulation of Gliogenesis by lin-32/Atoh1 in Caenorhabditis elegans. G3 (Bethesda) 2020 10(9) 3271-3278  [ PubMed ID = 32665354 ] [ RRC reference ] Hori S, Oda S, Suehiro Y, Iino Y, Mitani S. OFF-responses of interneurons optimize avoidance behaviors depending on stimulus strength via electrical synapses. PLoS Genet 2018 14(6) e1007477  [ PubMed ID = 29939997 ] [ RRC reference ] Rojo Romanos T, Ng L, Pocock R. Behavioral Assays to Study Oxygen and Carbon Dioxide Sensing in Caenorhabditis elegans. Bio Protoc 2018 8(1)   [ PubMed ID = 29335676 ] [ RRC reference ] Rojo Romanos T, Pladevall-Morera D, Langebeck-Jensen K, Hansen S, Ng L, Pocock R. LIN-32/Atonal Controls Oxygen Sensing Neuron Development in Caenorhabditis elegans. Sci Rep 2017 7(1) 7294  [ PubMed ID = 28779171 ] [ RRC reference ] Li Y, Zhao D, Horie T, Chen G, Bao H, Chen S, Liu W, Horie R, Liang T, Dong B, Feng Q, Tao Q, Liu X. Conserved gene regulatory module specifies lateral neural borders across bilaterians. Proc Natl Acad Sci U S A 2017 114(31) E6352-E6360  [ PubMed ID = 28716930 ] [ RRC reference ] Sallee MD, Littleford HE, Greenwald I. A bHLH Code for Sexually Dimorphic Form and Function of the C. elegans Somatic Gonad. Curr Biol 2017 27(12) 1853-1860.e5  [ PubMed ID = 28602651 ] [ RRC reference ] Zhu Z, Liu J, Yi P, Tian D, Chai Y, Li W, Ou G. A proneural gene controls C. elegans neuroblast asymmetric division and migration. FEBS Lett 2014 588(7) 1136-43  [ PubMed ID = 24589937 ] [ RRC reference ] Miller RM, Portman DS. The Wnt/beta-catenin asymmetry pathway patterns the atonal ortholog lin-32 to diversify cell fate in a Caenorhabditis elegans sensory lineage. J Neurosci 2011 31(37) 13281-91  [ PubMed ID = 21917811 ] [ RRC reference ] Doitsidou M, Flames N, Lee AC, Boyanov A, Hobert O. Automated screening for mutants affecting dopaminergic-neuron specification in C. elegans. Nat Methods 2008 5(10) 869-72  [ PubMed ID = 18758453 ] [ RRC reference ]