| Allele Name | tm1429 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F52G2.2 |
| Gene Name | rsd-2 |
| Worm Base | Allele Name |
tm1429
|
| Gene Name |
rsd-2
|
| Sequence |
F52G2.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 16237/16238-16688/16689 (451 bp deletion) |
| Chromosome | IV |
| Putative gene structure | complement(join(6222..6257, 7000..7560, 8484..8723, 9864..10040, 10106..10208, 10261..10416, 13378..13486, 13537..13712, 13763..13890, 14848..14953, 15007..15170, 15756..15972, 16439..16717, 16765..16941, 18397..18762, 21479..21621, 21677..21809, 22667..22801, 23304..23441, 23489..23742)) |
| Map position | 9.5 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:CTACTAAACCGGTTACGTGT,ExtFwd:CGACGTCTCCAAAGCACGTC,IntRev:CCACAGGGATTTTGTAGGGA,ExtRev:ATATTTCGGGCCACAGGGAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Chen S, Liu W, Xiong L, Tao Z, Zhao D. Tissue-specific silencing of integrated transgenes achieved through endogenous RNA interference in Caenorhabditis elegans. RNA Biol 2024 21(1) 1-10
[ PubMed ID = 38531838 ]
[ RRC reference ]
|
Baiocchi T, Anesko K, Mercado N, Park H, Kin K, Strickhouser-Monzon B, Robles P, Bowman C, Wang H, Sternberg PW, Dillman AR. Signaling by AWC Olfactory Neurons Is Necessary for Caenorhabditis elegans' Response to Prenol, an Odor Associated with Nematode-Infected Insects. Genetics 2020 216(1) 145-157
[ PubMed ID = 32680884 ]
[ RRC reference ]
|
Guo X, Zhang R, Wang J, Lu R. Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans. J Virol 2013 87(19) 10721-9
[ PubMed ID = 23885080 ]
[ RRC reference ]
|
Zhang C, Montgomery TA, Fischer SE, Garcia SM, Riedel CG, Fahlgren N, Sullivan CM, Carrington JC, Ruvkun G. The Caenorhabditis elegans RDE-10/RDE-11 complex regulates RNAi by promoting secondary siRNA amplification. Curr Biol 2012 22(10) 881-90
[ PubMed ID = 22542102 ]
[ RRC reference ]
|
|