分離済み変異体

tm1429

Allele Nametm1429
BalanceNot Required
OutCrossNot Accepted
Sequence NameF52G2.2
Gene Namersd-2
Worm BaseAllele Name tm1429
Gene Name rsd-2
Sequence F52G2.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16237/16238-16688/16689 (451 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(6222..6257, 7000..7560, 8484..8723, 9864..10040, 10106..10208, 10261..10416, 13378..13486, 13537..13712, 13763..13890, 14848..14953, 15007..15170, 15756..15972, 16439..16717, 16765..16941, 18397..18762, 21479..21621, 21677..21809, 22667..22801, 23304..23441, 23489..23742))
Map position9.5
Balancer
Map position of balancer
Sequence of primersIntFwd:CTACTAAACCGGTTACGTGT,ExtFwd:CGACGTCTCCAAAGCACGTC,IntRev:CCACAGGGATTTTGTAGGGA,ExtRev:ATATTTCGGGCCACAGGGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen S, Liu W, Xiong L, Tao Z, Zhao D.
Tissue-specific silencing of integrated transgenes achieved through endogenous RNA interference in Caenorhabditis elegans.
RNA Biol 2024 21(1) 1-10 
[ PubMed ID = 38531838 ] [ RRC reference ]

Baiocchi T, Anesko K, Mercado N, Park H, Kin K, Strickhouser-Monzon B, Robles P, Bowman C, Wang H, Sternberg PW, Dillman AR.
Signaling by AWC Olfactory Neurons Is Necessary for Caenorhabditis elegans' Response to Prenol, an Odor Associated with Nematode-Infected Insects.
Genetics 2020 216(1) 145-157 
[ PubMed ID = 32680884 ] [ RRC reference ]

Guo X, Zhang R, Wang J, Lu R.
Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans.
J Virol 2013 87(19) 10721-9 
[ PubMed ID = 23885080 ] [ RRC reference ]

Zhang C, Montgomery TA, Fischer SE, Garcia SM, Riedel CG, Fahlgren N, Sullivan CM, Carrington JC, Ruvkun G.
The Caenorhabditis elegans RDE-10/RDE-11 complex regulates RNAi by promoting secondary siRNA amplification.
Curr Biol 2012 22(10) 881-90 
[ PubMed ID = 22542102 ] [ RRC reference ]