| Allele Name | tm1417 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | ZK1290.12 |
| Gene Name | wrt-1 |
| Worm Base | Allele Name |
tm1417
|
| Gene Name |
wrt-1
|
| Sequence |
ZK1290.12
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 8567/8568-GAG-9218/9219 (651 bp deletion + 3 bp insertion) |
| Chromosome | II |
| Putative gene structure | join(7876..8073, 8417..8589, 8634..8804, 8851..9482, 9553..9833) |
| Map position | 0.5 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:TCTGTAACGCAGTTAGCCTT,IntFwd:TGTCTCTTCCTGACGGCTAC,ExtFwd:GTACAGACTGTCGCAGATTG,IntRev:CTGCGGAGTCATATCGATAA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Falsztyn IB, Jordan JM, Chen J, Zhao W, Chitrakar R, Reinke AW, Baugh LR. Early life starvation and Hedgehog-related signaling activate innate immunity downstream of daf-18/PTEN and lin-35/Rb causing developmental pathology in adult C. elegans. PLoS Genet 2025 21(12) e1011641
[ PubMed ID = 41336845 ]
[ RRC reference ]
|
Hall AN, Morton EA, Walters R, Cuperus JT, Queitsch C. Phenotypic tolerance for rDNA copy number variation within the natural range of C. elegans. PLoS Genet 2025 21(7) e1011759
[ PubMed ID = 40601579 ]
[ RRC reference ]
|
Baker EA, Gilbert SPR, Shimeld SM, Woollard A. Extensive non-redundancy in a recently duplicated developmental gene family. BMC Ecol Evol 2021 21(1) 33
[ PubMed ID = 33648446 ]
[ RRC reference ]
|
Roberts AF, Gumienny TL, Gleason RJ, Wang H, Padgett RW. Regulation of genes affecting body size and innate immunity by the DBL-1/BMP-like pathway in Caenorhabditis elegans. BMC Dev Biol 2010 10 61
[ PubMed ID = 20529267 ]
[ RRC reference ]
|
|