分離済み変異体

tm1416

Allele Name

tm1416

Balance

Not Required

OutCross

Not Accepted

Sequence Name

F13E6.4

Gene Name

yap-1

Worm Base

Allele Name

tm1416

Gene Name

yap-1

Sequence

F13E6.4

Phenotype

homozygous viable. Dr. S. Boulton: non-Him, normal meiosis, not sensitive to IR or CDDP. Not required for BRC-1 focus formation after IR. Not required for FCD-2 focus formation after CDDP. Dr. J. Lee: protruding vulva.

Mutation site

22405/22406-22931/22932 (526 bp deletion)

Chromosome

Putative gene structure

join(21516..21668, 21977..22045, 22091..22212, 22258..22318, 22366..22717, 22974..23269, 23323..23430, 23691..23813, 23859..23948)

Map position

2.37

Balancer

Map position of balancer

Sequence of primers

ExtRev:GGTGCAATGTATGCGGTGTC,IntRev:GTTGCGGACTGTCGACAAGT,ExtFwd:TGCCGGATGTGAGGGATGGA,IntFwd:GGGATGGAAACGCCTCCGAT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Goyala A, Statzer C, Park JYC, Neundorf I, MacArthur MR, Gebauer JM, Ewald CY.
A centenarian single nucleotide polymorphism in collagen gene COL25A1 promotes longevity in C. elegans.
NPJ Aging 2025 11(1) 81
[ PubMed ID = 41027912 ] [ RRC reference ]

Lee H, Kang J, Lee SH, Lee D, Chung CH, Lee J.
Neuroprotective role of Hippo signaling by microtubule stability control in Caenorhabditis elegans.
Elife 2025 13
[ PubMed ID = 40178516 ] [ RRC reference ]

Brinzer RA, Winter AD, Page AP.
The relationship between intraflagellar transport and upstream protein trafficking pathways and macrocyclic lactone resistance in Caenorhabditis elegans.
G3 (Bethesda) 2024 14(3)
[ PubMed ID = 38227795 ] [ RRC reference ]

Teuscher AC, Statzer C, Goyala A, Domenig SA, Schoen I, Hess M, Hofer AM, Fossati A, Vogel V, Goksel O, Aebersold R, Ewald CY.
Longevity interventions modulate mechanotransduction and extracellular matrix homeostasis in C. elegans.
Nat Commun 2024 15(1) 276
[ PubMed ID = 38177158 ] [ RRC reference ]

Stojanovski K, Gheorghe I, Lenart P, Lanjuin A, Mair WB, Towbin BD.
Maintenance of appropriate size scaling of the C. elegans pharynx by YAP-1.
Nat Commun 2023 14(1) 7564
[ PubMed ID = 37985670 ] [ RRC reference ]

Ma YC, Yang ZS, Ma LQ, Shu R, Zou CG, Zhang KQ.
YAP in epithelium senses gut barrier loss to deploy defenses against pathogens.
PLoS Pathog 2020 16(8) e1008766
[ PubMed ID = 32857822 ] [ RRC reference ]

Lee H, Kang J, Lee J.
Involvement of YAP-1, the Homolog of Yes-Associated Protein, in the Wnt-Mediated Neuronal Polarization in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(8) 2595-2602
[ PubMed ID = 29853655 ] [ RRC reference ]

Feng G, Zhu Z, Li WJ, Lin Q, Chai Y, Dong MQ, Ou G.
Hippo kinases maintain polarity during directional cell migration in Caenorhabditis elegans.
EMBO J 2017 36(3) 334-345
[ PubMed ID = 28011581 ] [ RRC reference ]

Iwasa H, Maimaiti S, Kuroyanagi H, Kawano S, Inami K, Timalsina S, Ikeda M, Nakagawa K, Hata Y.
Yes-associated protein homolog, YAP-1, is involved in the thermotolerance and aging in the nematode Caenorhabditis elegans.
Exp Cell Res 2013 319(7) 931-45
[ PubMed ID = 23396260 ] [ RRC reference ]