分離済み変異体

tm1414

Allele Nametm1414
BalanceNot Required
OutCrossNot Accepted
Sequence NameR06C7.1
Gene Namewago-1
Worm BaseAllele Name tm1414
Gene Name wago-1
Sequence R06C7.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4662/4663-5644/5645 (982 bp deletion)
ChromosomeI
Putative gene structurejoin(3063..3227, 3274..3854, 3899..4631, 4680..4855, 4899..5074, 5117..5463, 5510..5749, 5790..6097, 6143..6254)
Map position1.85
Balancer
Map position of balancer
Sequence of primersExtFwd:CTCGAGATTTATGCCCCAAG,IntFwd:GCCCCAAGGGACAACTCTAT,ExtRev:CGGTCCATTGGAGCTTTGCA,IntRev:CGGATTCGTGACAGCGTTAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Marnik EA, Almeida MV, Cipriani PG, Chung G, Caspani E, Karaulanov E, Gan HH, Zinno J, Isolehto IJ, Kielisch F, Butter F, Sharp CS, Flanagan RM, Bonnet FX, Piano F, Ketting RF, Gunsalus KC, Updike DL.
The Caenorhabditis elegans TDRD5/7-like protein, LOTR-1, interacts with the helicase ZNFX-1 to balance epigenetic signals in the germline.
PLoS Genet 2022 18(6) e1010245 
[ PubMed ID = 35657999 ] [ RRC reference ]

Placentino M, de Jesus Domingues AM, Schreier J, Dietz S, Hellmann S, de Albuquerque BF, Butter F, Ketting RF.
Intrinsically disordered protein PID-2 modulates Z granules and is required for heritable piRNA-induced silencing in the Caenorhabditis elegans embryo.
EMBO J 2021 40(3) e105280 
[ PubMed ID = 33231880 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
mBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Shirayama M, Seth M, Lee HC, Gu W, Ishidate T, Conte D Jr, Mello CC.
piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.
Cell 2012 150(1) 65-77 
[ PubMed ID = 22738726 ] [ RRC reference ]

Gu W, Shirayama M, Conte D Jr, Vasale J, Batista PJ, Claycomb JM, Moresco JJ, Youngman EM, Keys J, Stoltz MJ, Chen CC, Chaves DA, Duan S, Kasschau KD, Fahlgren N, Yates JR 3rd, Mitani S, Carrington JC, Mello CC.
Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline.
Mol Cell 2009 36(2) 231-44 
[ PubMed ID = 19800275 ] [ RRC reference ]