分離済み変異体

tm1414

Allele Name

tm1414

Allele Type

通常株

Sequence Name

R06C7.1

Gene Name

wago-1

Worm Base

Allele Name

tm1414

Gene Name

wago-1

Sequence

R06C7.1

Phenotype

homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).

Mutation site

4662/4663-5644/5645 (982 bp deletion)

Chromosome

Putative gene structure

join(3063..3227, 3274..3854, 3899..4631, 4680..4855, 4899..5074, 5117..5463, 5510..5749, 5790..6097, 6143..6254)

Map position

1.85

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CTCGAGATTTATGCCCCAAG,IntFwd:GCCCCAAGGGACAACTCTAT,ExtRev:CGGTCCATTGGAGCTTTGCA,IntRev:CGGATTCGTGACAGCGTTAT

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Marnik EA, Almeida MV, Cipriani PG, Chung G, Caspani E, Karaulanov E, Gan HH, Zinno J, Isolehto IJ, Kielisch F, Butter F, Sharp CS, Flanagan RM, Bonnet FX, Piano F, Ketting RF, Gunsalus KC, Updike DL.
The Caenorhabditis elegans TDRD5/7-like protein, LOTR-1, interacts with the helicase ZNFX-1 to balance epigenetic signals in the germline.
PLoS Genet 2022 18(6) e1010245
[ PubMed ID = 35657999 ] [ RRC reference ]

Placentino M, de Jesus Domingues AM, Schreier J, Dietz S, Hellmann S, de Albuquerque BF, Butter F, Ketting RF.
Intrinsically disordered protein PID-2 modulates Z granules and is required for heritable piRNA-induced silencing in the Caenorhabditis elegans embryo.
EMBO J 2021 40(3) e105280
[ PubMed ID = 33231880 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
mBio 2017 8(5)
[ PubMed ID = 29018118 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19
[ PubMed ID = 23329696 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32
[ PubMed ID = 24532782 ] [ RRC reference ]

Shirayama M, Seth M, Lee HC, Gu W, Ishidate T, Conte D Jr, Mello CC.
piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.
Cell 2012 150(1) 65-77
[ PubMed ID = 22738726 ] [ RRC reference ]

Gu W, Shirayama M, Conte D Jr, Vasale J, Batista PJ, Claycomb JM, Moresco JJ, Youngman EM, Keys J, Stoltz MJ, Chen CC, Chaves DA, Duan S, Kasschau KD, Fahlgren N, Yates JR 3rd, Mitani S, Carrington JC, Mello CC.
Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline.
Mol Cell 2009 36(2) 231-44
[ PubMed ID = 19800275 ] [ RRC reference ]