分離済み変異体

tm1411

Allele Name

tm1411

Balance

Completed

OutCross

Not Accepted

Sequence Name

F33D11.11

Gene Name

F33D11.11

Worm Base

Allele Name

tm1411 (x1)

Gene Name

F33D11.11

Sequence

F33D11.11

Phenotype

lethal or sterile. Dr. A. Chisholm: maternal effect Let, morphogenesis defects.

Mutation site

36170/36171-ATATGTATATA-36827/36828 (657 bp deletion + 11 bp insertion)

Chromosome

Putative gene structure

complement(join(35659..35787, 35874..36021, 36113..36398, 36557..36731))

Map position

0.47

Balancer

hT2,hT2 [bli-4(e937) let-? qIs48]

Map position of balancer

Sequence of primers

ExtFwd:ACTCCGAGATAATACGGCGA,IntFwd:TTGGGGGAACGGGGAACCAT,ExtRev:ACGCTTGCCTCTAGGCACTA,IntRev:TAGGCACTAAGCACTGGCCA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Lee H, Kang J, Lee SH, Lee D, Chung CH, Lee J.
Neuroprotective role of Hippo signaling by microtubule stability control in Caenorhabditis elegans.
Elife 2025 13
[ PubMed ID = 40178516 ] [ RRC reference ]

Cottee PA, Cole T, Schultz J, Hoang HD, Vibbert J, Han SM, Miller MA.
The C. elegans VAPB homolog VPR-1 is a permissive signal for gonad development.
Development 2017 144(12) 2187-2199
[ PubMed ID = 28634273 ] [ RRC reference ]

Schultz J, Lee SJ, Cole T, Hoang HD, Vibbert J, Cottee PA, Miller MA, Han SM.
The secreted MSP domain of C. elegans VAPB homolog VPR-1 patterns the adult striated muscle mitochondrial reticulum via SMN-1.
Development 2017 144(12) 2175-2186
[ PubMed ID = 28634272 ] [ RRC reference ]

Walck-Shannon E, Lucas B, Chin-Sang I, Reiner D, Kumfer K, Cochran H, Bothfeld W, Hardin J.
CDC-42 Orients Cell Migration during Epithelial Intercalation in the Caenorhabditis elegans Epidermis.
PLoS Genet 2016 12(11) e1006415
[ PubMed ID = 27861585 ] [ RRC reference ]

Han SM, El Oussini H, Scekic-Zahirovic J, Vibbert J, Cottee P, Prasain JK, Bellen HJ, Dupuis L, Miller MA.
VAPB/ALS8 MSP ligands regulate striated muscle energy metabolism critical for adult survival in caenorhabditis elegans.
PLoS Genet 2013 9(9) e1003738
[ PubMed ID = 24039594 ] [ RRC reference ]

Han SM, Tsuda H, Yang Y, Vibbert J, Cottee P, Lee SJ, Winek J, Haueter C, Bellen HJ, Miller MA.
Secreted VAPB/ALS8 major sperm protein domains modulate mitochondrial localization and morphology via growth cone guidance receptors.
Dev Cell 2012 22(2) 348-62
[ PubMed ID = 22264801 ] [ RRC reference ]

Tsuda H, Han SM, Yang Y, Tong C, Lin YQ, Mohan K, Haueter C, Zoghbi A, Harati Y, Kwan J, Miller MA, Bellen HJ.
The amyotrophic lateral sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors.
Cell 2008 133(6) 963-77
[ PubMed ID = 18555774 ] [ RRC reference ]