分離済み変異体

tm1406

Allele Name

tm1406

Allele Type

通常株

Sequence Name

Y41G9A.4

Gene Name

gbb-1

Worm Base

Allele Name

tm1406

Gene Name

gbb-1

Sequence

Y41G9A.4

Phenotype

homozygous viable. Dr. C.L. Creasy: fertile, normal locomotion, normal egg-laying, solitary social feeding. Dr. J. Kaplan: J. Neurosci 28, 7104 (2008).

Mutation site

12233/12234-13514/13515 (1281 bp deletion)

Chromosome

Putative gene structure

join(11763..11897, 12422..12556, 12610..12707, 12753..12843, 12895..13041, 13356..13469, 13520..13701, 13896..14034, 14083..14289, 15055..15143, 15193..15331, 16279..16404, 17874..18005, 19967..20089, 20135..20216, 20261..20473, 20849..21018, 21067..21178, 21228..21308, 21358..21425)

Map position

-12.67

Balancer

Map position of balancer

Sequence of primers

ExtRev:CGAGTCTGGTGGTGGTCCTT,IntFwd:GGACTCAGTTTGGACACACA,ExtFwd:ACGTTTTGACTGCCAGTAAC,IntRev:CCCATGATCTTGTACTTTCC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Zheng Z, Zhang X, Liu J, He P, Zhang S, Zhang Y, Gao J, Yang S, Kang N, Afridi MI, Gao S, Chen C, Tu H.
GABAergic synapses suppress intestinal innate immunity via insulin signaling in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2021 118(20)
[ PubMed ID = 33972423 ] [ RRC reference ]

Yuan F, Zhou J, Xu L, Jia W, Chun L, Xu XZS, Liu J.
GABA receptors differentially regulate life span and health span in C. elegans through distinct downstream mechanisms.
Am J Physiol Cell Physiol 2019 317(5) C953-C963
[ PubMed ID = 31433690 ] [ RRC reference ]

Schultheis C, Brauner M, Liewald JF, Gottschalk A.
Optogenetic analysis of GABAB receptor signaling in Caenorhabditis elegans motor neurons.
J Neurophysiol 2011 106(2) 817-27
[ PubMed ID = 21613582 ] [ RRC reference ]

Hawkins EG, Martin I, Kondo LM, Judy ME, Brings VE, Chan CL, Blackwell GG, Bettinger JC, Davies AG.
A novel cholinergic action of alcohol and the development of tolerance to that effect in Caenorhabditis elegans.
Genetics 2015 199(1) 135-49
[ PubMed ID = 25342716 ] [ RRC reference ]

Han B, Bellemer A, Koelle MR.
An evolutionarily conserved switch in response to GABA affects development and behavior of the locomotor circuit of Caenorhabditis elegans.
Genetics 2015 199(4) 1159-72
[ PubMed ID = 25644702 ] [ RRC reference ]

Chun L, Gong J, Yuan F, Zhang B, Liu H, Zheng T, Yu T, Xu XZ, Liu J.
Metabotropic GABA signalling modulates longevity in C. elegans.
Nat Commun 2015 6 8828
[ PubMed ID = 26537867 ] [ RRC reference ]

Dittman JS, Kaplan JM.
Behavioral impact of neurotransmitter-activated G-protein-coupled receptors: muscarinic and GABAB receptors regulate Caenorhabditis elegans locomotion.
J Neurosci 2008 28(28) 7104-12
[ PubMed ID = 18614679 ] [ RRC reference ]