Home > 分離済み変異体 > tm1395

分離済み変異体

Allele Name		tm1395
Balance		Not Required
OutCross		Not Accepted
Sequence Name		Y71F9B.7
Gene Name		plk-2
Worm Base	Allele Name	tm1395
	Gene Name	plk-2
	Sequence	Y71F9B.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. M. Zetka: high incidence of embryonic lethality and mild Him. Dr. J. Kaplan: weak hypersensitivity to aldicarb, not GLR::GFP phenotype. Dr. A. Dernburg: ~65% embryonic inviability, Him.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		55179/55180-55539/55540 (360 bp deletion)
Chromosome		I
Putative gene structure		complement(join(54227..54529, 54576..55019, 55068..55502, 55793..55905, 55954..56245, 56302..56613))
Map position		-7.27
Balancer
Map position of balancer
Sequence of primers		IntFwd:CAGGCGATTGATACGAGTCT,ExtFwd:GCCAGCAGTGTCCAGCATGA,IntRev:GGCCCATAAACACAGCTGAC,ExtRev:GTTCGGACTACCGTACCCAG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Gold AL, Hurlock ME, Guevara AM, Isenberg LYZ, Kim Y. Identification of the Polo-like kinase substrate required for homologous synapsis. J Cell Biol 2025 224(3)   [ PubMed ID = 39680026 ] [ RRC reference ] Brandt JN, Hussey KA, Kim Y. Spatial and temporal control of targeting Polo-like kinase during meiotic prophase. J Cell Biol 2020 219(11)   [ PubMed ID = 32997737 ] [ RRC reference ] Link J, Paouneskou D, Velkova M, Daryabeigi A, Laos T, Labella S, Barroso C, Pacheco Piñol S, Montoya A, Kramer H, Woglar A, Baudrimont A, Markert SM, Stigloher C, Martinez-Perez E, Dammermann A, Alsheimer M, Zetka M, Jantsch V. Transient and Partial Nuclear Lamina Disruption Promotes Chromosome Movement in Early Meiotic Prophase. Dev Cell 2018 45(2) 212-225.e7  [ PubMed ID = 29689196 ] [ RRC reference ] Ferrandiz N, Barroso C, Telecan O, Shao N, Kim HM, Testori S, Faull P, Cutillas P, Snijders AP, Colaiácovo MP, Martinez-Perez E. Spatiotemporal regulation of Aurora B recruitment ensures release of cohesion during C. elegans oocyte meiosis. Nat Commun 2018 9(1) 834  [ PubMed ID = 29483514 ] [ RRC reference ] Kim Y, Kostow N, Dernburg AF. The Chromosome Axis Mediates Feedback Control of CHK-2 to Ensure Crossover Formation in C. elegans. Dev Cell 2015 35(2) 247-61  [ PubMed ID = 26506311 ] [ RRC reference ] Harper NC, Rillo R, Jover-Gil S, Assaf ZJ, Bhalla N, Dernburg AF. Pairing centers recruit a Polo-like kinase to orchestrate meiotic chromosome dynamics in C. elegans. Dev Cell 2011 21(5) 934-47  [ PubMed ID = 22018922 ] [ RRC reference ] Labella S, Woglar A, Jantsch V, Zetka M. Polo kinases establish links between meiotic chromosomes and cytoskeletal forces essential for homolog pairing. Dev Cell 2011 21(5) 948-58  [ PubMed ID = 22018921 ] [ RRC reference ] Gottschalk A, Almedom RB, Schedletzky T, Anderson SD, Yates JR 3rd, Schafer WR. Identification and characterization of novel nicotinic receptor-associated proteins in Caenorhabditis elegans. EMBO J 2005 24(14) 2566-78  [ PubMed ID = 15990870 ] [ RRC reference ]