分離済み変異体

tm1392

Allele Nametm1392
BalanceNot Required
OutCrossNot Accepted
Sequence NameC52B11.3
Gene Namedop-4
Worm BaseAllele Name tm1392
Gene Name dop-4
Sequence C52B11.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 22707/22708-23791/23792 (1084 bp deletion)
ChromosomeX
Putative gene structurejoin(22117..22308, 22484..22734, 22787..22951, 23379..23567, 23781..23937, 24327..24485, 24535..24702, 24797..24982, 25143..25358, 25637..25848, 27351..27389, 27431..27464, 27521..27631)
Map position-18.46
Balancer
Map position of balancer
Sequence of primersIntFwd:GTGAGGCGGCTGTTTGCTAA,ExtFwd:CGCTGTCTGAACTCGGTCGA,IntRev:ACCACCATCCCCCTATCTAA,ExtRev:TCAGTGCAAGGCACGTTCTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Wang Z, Zhang Q, Jiang Y, Zhou J, Tian Y.
ASI-RIM neuronal axis regulates systemic mitochondrial stress response via TGF-β signaling cascade.
Nat Commun 2024 15(1) 8997 
[ PubMed ID = 39426950 ] [ RRC reference ]

Kim AT, Li S, Kim Y, You YJ, Park Y.
Food preference-based screening method for identification of effectors of substance use disorders using Caenorhabditis elegans.
Life Sci 2024 345 122580 
[ PubMed ID = 38514005 ] [ RRC reference ]

Ji H, Fouad AD, Li Z, Ruba A, Fang-Yen C.
A proprioceptive feedback circuit drives Caenorhabditis elegans locomotor adaptation through dopamine signaling.
Proc Natl Acad Sci U S A 2023 120(20) e2219341120 
[ PubMed ID = 37155851 ] [ RRC reference ]

Miller HA, Huang S, Dean ES, Schaller ML, Tuckowski AM, Munneke AS, Beydoun S, Pletcher SD, Leiser SF.
Serotonin and dopamine modulate aging in response to food odor and availability.
Nat Commun 2022 13(1) 3271 
[ PubMed ID = 35672307 ] [ RRC reference ]

Fernandez RW, Wei K, Wang EY, Mikalauskaite D, Olson A, Pepper J, Christie N, Kim S, Weissenborn S, Sarov M, Koelle MR.
Cellular Expression and Functional Roles of All 26 Neurotransmitter GPCRs in the C. elegans Egg-Laying Circuit.
J Neurosci 2020 40(39) 7475-7488 
[ PubMed ID = 32847964 ] [ RRC reference ]

Suo S, Harada K, Matsuda S, Kyo K, Wang M, Maruyama K, Awaji T, Tsuboi T.
Sexually Dimorphic Regulation of Behavioral States by Dopamine in Caenorhabditis elegans.
J Neurosci 2019 39(24) 4668-4683 
[ PubMed ID = 30988167 ] [ RRC reference ]

Oakes M, Law WJ, Komuniecki R.
Cannabinoids Stimulate the TRP Channel-Dependent Release of Both Serotonin and Dopamine to Modulate Behavior in C. elegans.
J Neurosci 2019 39(21) 4142-4152 
[ PubMed ID = 30886012 ] [ RRC reference ]

Perez-Gomez A, Carretero M, Weber N, Peterka V, To A, Titova V, Solis G, Osborn O, Petrascheck M.
A phenotypic Caenorhabditis elegans screen identifies a selective suppressor of antipsychotic-induced hyperphagia.
Nat Commun 2018 9(1) 5272 
[ PubMed ID = 30532051 ] [ RRC reference ]

Essmann CL, Ryan KR, Elmi M, Bryon-Dodd K, Porter A, Vaughan A, McMullan R, Nurrish S.
Activation of RHO-1 in cholinergic motor neurons competes with dopamine signalling to control locomotion.
PLoS One 2018 13(9) e0204057 
[ PubMed ID = 30240421 ] [ RRC reference ]

Cao X, Aballay A.
Neural Inhibition of Dopaminergic Signaling Enhances Immunity in a Cell-Non-autonomous Manner.
Curr Biol 2016 26(17) 2329-34 
[ PubMed ID = 27524480 ] [ RRC reference ]

Joshi KK, Matlack TL, Rongo C.
Dopamine signaling promotes the xenobiotic stress response and protein homeostasis.
EMBO J 2016 35(17) 1885-901 
[ PubMed ID = 27261197 ] [ RRC reference ]

Safratowich BD, Hossain M, Bianchi L, Carvelli L.
Amphetamine potentiates the effects of β-phenylethylamine through activation of an amine-gated chloride channel.
J Neurosci 2014 34(13) 4686-91 
[ PubMed ID = 24672014 ] [ RRC reference ]

Topper SM, Aguilar SC, Topper VY, Elbel E, Pierce-Shimomura JT.
Alcohol disinhibition of behaviors in C. elegans.
PLoS One 2014 9(3) e92965 
[ PubMed ID = 24681782 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc Natl Acad Sci U S A 2013 110(29) 11940-5 
[ PubMed ID = 23818641 ] [ RRC reference ]

Sellings L, Pereira S, Qian C, Dixon-McDougall T, Nowak C, Zhao B, Tyndale RF, van der Kooy D.
Nicotine-motivated behavior in Caenorhabditis elegans requires the nicotinic acetylcholine receptor subunits acr-5 and acr-15.
Eur J Neurosci 2013 37(5) 743-56 
[ PubMed ID = 23351035 ] [ RRC reference ]

Brown AE, Yemini EI, Grundy LJ, Jucikas T, Schafer WR.
A dictionary of behavioral motifs reveals clusters of genes affecting Caenorhabditis elegans locomotion.
Proc Natl Acad Sci U S A 2013 110(2) 791-6 
[ PubMed ID = 23267063 ] [ RRC reference ]

Correa P, LeBoeuf B, García LR.
C. elegans dopaminergic D2-like receptors delimit recurrent cholinergic-mediated motor programs during a goal-oriented behavior.
PLoS Genet 2012 8(11) e1003015 
[ PubMed ID = 23166505 ] [ RRC reference ]

Vidal-Gadea A, Topper S, Young L, Crisp A, Kressin L, Elbel E, Maples T, Brauner M, Erbguth K, Axelrod A, Gottschalk A, Siegel D, Pierce-Shimomura JT.
Caenorhabditis elegans selects distinct crawling and swimming gaits via dopamine and serotonin.
Proc Natl Acad Sci U S A 2011 108(42) 17504-9 
[ PubMed ID = 21969584 ] [ RRC reference ]

Ezak MJ, Ferkey DM.
The C. elegans D2-like dopamine receptor DOP-3 decreases behavioral sensitivity to the olfactory stimulus 1-octanol.
PLoS One 2010 5(3) e9487 
[ PubMed ID = 20209143 ] [ RRC reference ]