分離済み変異体

tm1362

Allele Name

tm1362

Balance

Not Required

OutCross

Not Accepted

Sequence Name

K03E6.6

Gene Name

pfn-3

Worm Base

Allele Name

tm1362

Gene Name

pfn-3

Sequence

K03E6.6

Phenotype

homozygous viable. Dr. S. Ono: Cell Motil Cytoskeleton 63, 14-28 (2006).

Mutation site

25817/25818-26615/26616 (798 bp deletion)

Chromosome

Putative gene structure

complement(join(25406..25503, 25556..25679, 25726..25773, 26375..26485))

Map position

-18.74

Balancer

Map position of balancer

Sequence of primers

ExtRev:TGATAACACTTCTGGTCCCG,IntFwd:CGCTGACGAGGTGGAGACTT,ExtFwd:TGGTCAGTCCCGGATAGCTG,IntRev:ATGTTAAGCACCTGGTCGTA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Kimmich MJ, Sundaramurthy S, Geary MA, Lesanpezeshki L, Yingling CV, Vanapalli SA, Littlefield RS, Pruyne D.
FHOD-1 and profilin protect sarcomeres against contraction-induced deformation> in C. elegans.
Mol Biol Cell 2024 35(11) ar137
[ PubMed ID = 39259762 ] [ RRC reference ]

Kimmich MJ, Sundaramurthy S, Geary MA, Lesanpezeshki L, Yingling CV, Vanapalli SA, Littlefield RS, Pruyne D.
FHOD-1/profilin-mediated actin assembly protects sarcomeres against contraction-induced deformation in C. elegans.
bioRxiv 2024
[ PubMed ID = 38559004 ] [ RRC reference ]

Lesanpezeshki L, Qadota H, Darabad MN, Kashyap K, Lacerda CMR, Szewczyk NJ, Benian GM, Vanapalli SA.
Investigating the correlation of muscle function tests and sarcomere organization in C. elegans.
Skelet Muscle 2021 11(1) 20
[ PubMed ID = 34389048 ] [ RRC reference ]

Lesanpezeshki L, Hewitt JE, Laranjeiro R, Antebi A, Driscoll M, Szewczyk NJ, Blawzdziewicz J, Lacerda CMR, Vanapalli SA.
Pluronic gel-based burrowing assay for rapid assessment of neuromuscular health in C. elegans.
Sci Rep 2019 9(1) 15246
[ PubMed ID = 31645584 ] [ RRC reference ]

Nahabedian JF, Qadota H, Stirman JN, Lu H, Benian GM.
Bending amplitude - a new quantitative assay of C. elegans locomotion: identification of phenotypes for mutants in genes encoding muscle focal adhesion components.
Methods 2012 56(1) 95-102
[ PubMed ID = 22126736 ] [ RRC reference ]

Yamashiro S, Cox EA, Baillie DL, Hardin JD, Ono S.
Sarcomeric actin organization is synergistically promoted by tropomodulin, ADF/cofilin, AIP1 and profilin in C. elegans.
J Cell Sci 2008 121(Pt 23) 3867-77
[ PubMed ID = 18984629 ] [ RRC reference ]

Polet D, Lambrechts A, Ono K, Mah A, Peelman F, Vandekerckhove J, Baillie DL, Ampe C, Ono S.
Caenorhabditis elegans expresses three functional profilins in a tissue-specific manner.
Cell Motil Cytoskeleton 2006 63(1) 14-28
[ PubMed ID = 16317718 ] [ RRC reference ]