分離済み変異体

tm1358

Allele Nametm1358
BalanceNot Required
OutCrossNot Accepted
Sequence NameT01C3.8
Gene Namemut-15
Worm BaseAllele Name tm1358
Gene Name mut-15
Sequence T01C3.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 17346/17347-17738/17739 (392 bp deletion)
ChromosomeV
Putative gene structurejoin(16100..16136, 16186..16253, 16296..16341, 16389..16461, 16509..16677, 16720..17195, 17244..17367, 17413..17518, 17563..17692, 17746..18016, 18071..18196)
Map position7.14
Balancer
Map position of balancer
Sequence of primersIntRev:GGTAAAGATCGCGGAACCAC,ExtRev:GATTGTCGATCCGCCAGGTA,IntFwd:GATATCGCGCACGGGTTTAA,ExtFwd:CGATTGCTGGAGCGAGTCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lowe DD, Shukla A, Kennedy SG.
Viral RNA pUGylation promotes antiviral immunity in C. elegans.
J Virol 2025 99(11) e0116925 
[ PubMed ID = 41165327 ] [ RRC reference ]

Dejima K, Yoshida K, Mitani S.
Dual roles of EGO-1 and RRF-1 in regulating germline exo-RNAi efficiency in Caenorhabditis elegans.
EMBO Rep 2025 26(18) 4503-4531 
[ PubMed ID = 40789965 ] [ RRC reference ]

Lowe DD, Newman M, Ruvkun G, Kennedy SG.
The microRNA miR-243 directs poly(UG) modification of a somatic mRNA in C. elegans.
MicroPubl Biol 2025 2025  
[ PubMed ID = 40880989 ] [ RRC reference ]

Suen KM, Braukmann F, Butler R, Bensaddek D, Akay A, Lin CC, Milonaitytė D, Doshi N, Sapetschnig A, Lamond A, Ladbury JE, Miska EA.
DEPS-1 is required for piRNA-dependent silencing and PIWI condensate organisation in Caenorhabditis elegans.
Nat Commun 2020 11(1) 4242 
[ PubMed ID = 32843637 ] [ RRC reference ]

Uebel CJ, Anderson DC, Mandarino LM, Manage KI, Aynaszyan S, Phillips CM.
Distinct regions of the intrinsically disordered protein MUT-16 mediate assembly of a small RNA amplification complex and promote phase separation of Mutator foci.
PLoS Genet 2018 14(7) e1007542 
[ PubMed ID = 30036386 ] [ RRC reference ]

Spracklin G, Fields B, Wan G, Becker D, Wallig A, Shukla A, Kennedy S.
The RNAi Inheritance Machinery of Caenorhabditis elegans.
Genetics 2017 206(3) 1403-1416 
[ PubMed ID = 28533440 ] [ RRC reference ]

Phillips CM, Brown KC, Montgomery BE, Ruvkun G, Montgomery TA.
piRNAs and piRNA-Dependent siRNAs Protect Conserved and Essential C. elegans Genes from Misrouting into the RNAi Pathway.
Dev Cell 2015 34(4) 457-65 
[ PubMed ID = 26279487 ] [ RRC reference ]

Tsai HY, Chen CC, Conte D Jr, Moresco JJ, Chaves DA, Mitani S, Yates JR 3rd, Tsai MD, Mello CC.
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.
Cell 2015 160(3) 407-19 
[ PubMed ID = 25635455 ] [ RRC reference ]

Phillips CM, Montgomery BE, Breen PC, Roovers EF, Rim YS, Ohsumi TK, Newman MA, van Wolfswinkel JC, Ketting RF, Ruvkun G, Montgomery TA.
MUT-14 and SMUT-1 DEAD box RNA helicases have overlapping roles in germline RNAi and endogenous siRNA formation.
Curr Biol 2014 24(8) 839-44 
[ PubMed ID = 24684932 ] [ RRC reference ]

Phillips CM, Montgomery TA, Breen PC, Ruvkun G.
MUT-16 promotes formation of perinuclear mutator foci required for RNA silencing in the C. elegans germline.
Genes Dev 2012 26(13) 1433-44 
[ PubMed ID = 22713602 ] [ RRC reference ]

Zhang C, Montgomery TA, Gabel HW, Fischer SE, Phillips CM, Fahlgren N, Sullivan CM, Carrington JC, Ruvkun G.
mut-16 and other mutator class genes modulate 22G and 26G siRNA pathways in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2011 108(4) 1201-8 
[ PubMed ID = 21245313 ] [ RRC reference ]