分離済み変異体

tm1357

Allele Nametm1357
BalanceNot Required
OutCrossNot Accepted
Sequence NameY59A8B.7
Gene Nameebp-1
Worm BaseAllele Name tm1357
Gene Name ebp-1
Sequence Y59A8B.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Ahringer: weak Egl, sluggish.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 116089/116090-AATA-116614/116615 (525 bp deletion + 4 bp insertion)
ChromosomeV
Putative gene structurejoin(114036..114182, 116140..116307, 117956..118128, 119940..120324, 122690..122767)
Map position13.51
Balancer
Map position of balancer
Sequence of primersExtFwd:CCGAACCGTTAGTCCTCCTG,ExtRev:AGAGCGGAGCTTTGCCGCTT,IntFwd:TTCGGGTACCACCACACGAT,IntRev:TGTGTCGCGAAGACAGGGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Chen X, Wang K, Mufti FUD, Xu D, Zhu C, Huang X, Zeng C, Jin Q, Huang X, Yan YH, Dong MQ, Feng X, Shi Y, Kennedy S, Guang S.
Germ granule compartments coordinate specialized small RNA production.
Nat Commun 2024 15(1) 5799 
[ PubMed ID = 38987544 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Puri D, Sharma S, Samaddar S, Ravivarma S, Banerjee S, Ghosh-Roy A.
Muscleblind-1 interacts with tubulin mRNAs to regulate the microtubule cytoskeleton in C. elegans mechanosensory neurons.
PLoS Genet 2023 19(8) e1010885 
[ PubMed ID = 37603562 ] [ RRC reference ]

Kumar S, Behera S, Basu A, Dey S, Ghosh-Roy A.
Swimming Exercise Promotes Post-injury Axon Regeneration and Functional Restoration through AMPK.
eNeuro 2021 8(3)  
[ PubMed ID = 34031101 ] [ RRC reference ]

Basu A, Dey S, Puri D, Das Saha N, Sabharwal V, Thyagarajan P, Srivastava P, Koushika SP, Ghosh-Roy A.
let-7 miRNA controls CED-7 homotypic adhesion and EFF-1-mediated axonal self-fusion to restore touch sensation following injury.
Proc Natl Acad Sci U S A 2017 114(47) E10206-E10215 
[ PubMed ID = 29109254 ] [ RRC reference ]

Yogev S, Cooper R, Fetter R, Horowitz M, Shen K.
Microtubule Organization Determines Axonal Transport Dynamics.
Neuron 2016 92(2) 449-460 
[ PubMed ID = 27764672 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5  
[ PubMed ID = 27661253 ] [ RRC reference ]