分離済み変異体

tm1356

Allele Nametm1356
BalanceNot Required
OutCrossNot Accepted
Sequence NameT14E8.3
Gene Namedop-3
Worm BaseAllele Name tm1356
Gene Name dop-3
Sequence T14E8.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 27857/27858-28329/28330 (472 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(23380..23408, 23458..23704, 23753..23932, 23988..24467, 24513..24639, 25078..25320, 25371..25444, 25486..25604, 25662..25726, 27723..27849, 27904..28022, 28280..28609, 28656..28745, 28804..28894, 28949..29120, 29418..29516, 29569..29733, 30923..31070, 31710..31861, 32573..32779))
Map position-2.78
Balancer
Map position of balancer
Sequence of primersIntFwd:ACTATCCCAGCCATGTCGCA,ExtFwd:GTTCCGGAAGGCATTTCGGA,ExtRev:TGCCGTAGCGTGGACTAGAA,IntRev:GAGCGAGCAAGAAGCTTACG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Wang Z, Zhang Q, Jiang Y, Zhou J, Tian Y.
ASI-RIM neuronal axis regulates systemic mitochondrial stress response via TGF-β signaling cascade.
Nat Commun 2024 15(1) 8997 
[ PubMed ID = 39426950 ] [ RRC reference ]

Maekawa T, Higashide D, Hara T, Matsumura K, Ide K, Miyatake T, Kimura KD, Takahashi S.
Cross-species behavior analysis with attention-based domain-adversarial deep neural networks.
Nat Commun 2021 12(1) 5519 
[ PubMed ID = 34535659 ] [ RRC reference ]

Yamazoe-Umemoto A, Fujita K, Iino Y, Iwasaki Y, Kimura KD.
Modulation of different behavioral components by neuropeptide and dopamine signalings in non-associative odor learning of Caenorhabditis elegans.
Neurosci Res 2015 99 22-33 
[ PubMed ID = 26068898 ] [ RRC reference ]

Kimura KD, Fujita K, Katsura I.
Enhancement of odor avoidance regulated by dopamine signaling in Caenorhabditis elegans.
J Neurosci 2010 30(48) 16365-75 
[ PubMed ID = 21123582 ] [ RRC reference ]

Chase DL, Koelle MR.
Biogenic amine neurotransmitters in C. elegans.
WormBook 2007  1-15 
[ PubMed ID = 18050501 ] [ RRC reference ]