分離済み変異体

tm1349

Allele Nametm1349
BalanceNot Required
OutCrossNot Accepted
Sequence NameB0205.3
Gene Namerpn-10
Worm BaseAllele Name tm1349
Gene Name rpn-10
Sequence B0205.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Kawahara: Mol. Biol. Cell 17, 5356-5371 (2006). Dr. M. Gotta: Genetics 174, 285 (2006). Dr. T. Hoppe: Nat. Cell Biol. 9, 379 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 25723/25724-GAATAAAC-26606/26607 (883 bp deletion + 8 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(24954..25325, 25379..25880, 26200..26340, 26392..26450, 26867..27190, 27239..27363, 27414..27579, 27625..27690, 27840..27911))
Map position5.06
Balancer
Map position of balancer
Sequence of primersIntRev:TGACAACACCACGTGACGAG,ExtFwd:TTGGGGTGGCTGGATGGTGA,IntFwd:GCTGCAAAAGTTCTGGGTTG,ExtRev:ACGCGTCGCCGTTTGATTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Zanetti S, Puoti A.
Sex determination in the Caenorhabditis elegans germline.
Adv Exp Med Biol 2013 757 41-69 
[ PubMed ID = 22872474 ] [ RRC reference ]

McCloskey RJ, Kemphues KJ.
Deubiquitylation machinery is required for embryonic polarity in Caenorhabditis elegans.
PLoS Genet 2012 8(11) e1003092 
[ PubMed ID = 23209443 ] [ RRC reference ]

Segref A, Torres S, Hoppe T.
A screenable in vivo assay to study proteostasis networks in Caenorhabditis elegans.
Genetics 2011 187(4) 1235-40 
[ PubMed ID = 21288877 ] [ RRC reference ]

Kuhlbrodt K, Janiesch PC, Kevei É, Segref A, Barikbin R, Hoppe T.
The Machado-Joseph disease deubiquitylase ATX-3 couples longevity and proteostasis.
Nat Cell Biol 2011 13(3) 273-81 
[ PubMed ID = 21317884 ] [ RRC reference ]

Hamer G, Matilainen O, Holmberg CI.
A photoconvertible reporter of the ubiquitin-proteasome system in vivo.
Nat Methods 2010 7(6) 473-8 
[ PubMed ID = 20453865 ] [ RRC reference ]

Pispa J, Palmén S, Holmberg CI, Jäntti J.
C. elegans dss-1 is functionally conserved and required for oogenesis and larval growth.
BMC Dev Biol 2008 8 51 
[ PubMed ID = 18471277 ] [ RRC reference ]

Janiesch PC, Kim J, Mouysset J, Barikbin R, Lochmüller H, Cassata G, Krause S, Hoppe T.
The ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human myopathy.
Nat Cell Biol 2007 9(4) 379-90 
[ PubMed ID = 17369820 ] [ RRC reference ]

Shimada M, Kanematsu K, Tanaka K, Yokosawa H, Kawahara H.
Proteasomal ubiquitin receptor RPN-10 controls sex determination in Caenorhabditis elegans.
Mol Biol Cell 2006 17(12) 5356-71 
[ PubMed ID = 17050737 ] [ RRC reference ]

Labbé JC, Pacquelet A, Marty T, Gotta M.
A genomewide screen for suppressors of par-2 uncovers potential regulators of PAR protein-dependent cell polarity in Caenorhabditis elegans.
Genetics 2006 174(1) 285-95 
[ PubMed ID = 16816419 ] [ RRC reference ]