| Allele Name | tm1329 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F15B10.2 |
| Gene Name | drh-1 |
| Worm Base | Allele Name |
tm1329
|
| Gene Name |
drh-1
|
| Sequence |
F15B10.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. R. Plasterk: extracts are proficient for in vitro Dicer activity. Dr. S. Boulton: not required for FCD-2 focus formation after CDDP. Dr. R. Lu: PLoS Pathogens 5, e1000286 (2009). |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 10039/10040-GGGAATACCGTAT-10522/10523 (483 bp deletion + 13 bp insertion) |
| Chromosome | IV |
| Putative gene structure | complement(join(5544..5684, 5737..5795, 5859..5946, 5998..6324, 6378..6667, 6715..6924, 6971..7094, 8576..8787, 8831..8935, 9003..9233, 9282..9409, 9459..9547, 9598..9678, 9721..9887, 9944..10032, 10362..10482, 10541..10860, 10911..10977, 11022..11196, 11246..11335)) |
| Map position | 3.21 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:ATACTCTGCCTCGAGCCGAT,ExtRev:CTCAGCTGTCAGCAAGCGTG,IntFwd:GCTAGCCGCCTGTTGATTCA,ExtFwd:TCTAGACTCATCGTCGAGTG |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Mao K, Breen P, Ruvkun G.
Mitochondrial dysfunction induces RNA interference in C. elegans through a pathway homologous to the mammalian RIG-I antiviral response.
PLoS Biol 2020 18(12) e3000996
[ PubMed ID = 33264285 ]
[ RRC reference ]
|
Long T, Meng F, Lu R.
Transgene-Assisted Genetic Screen Identifies rsd-6 and Novel Genes as Key Components of Antiviral RNA Interference in Caenorhabditis elegans.
J Virol 2018 92(17)
[ PubMed ID = 29950414 ]
[ RRC reference ]
|
Guo X, Zhang R, Wang J, Ding SW, Lu R.
Homologous RIG-I-like helicase proteins direct RNAi-mediated antiviral immunity in C. elegans by distinct mechanisms.
Proc Natl Acad Sci U S A 2013 110(40) 16085-90
[ PubMed ID = 24043766 ]
[ RRC reference ]
|
Guo X, Zhang R, Wang J, Lu R.
Antiviral RNA silencing initiated in the absence of RDE-4, a double-stranded RNA binding protein, in Caenorhabditis elegans.
J Virol 2013 87(19) 10721-9
[ PubMed ID = 23885080 ]
[ RRC reference ]
|
Juang BT, Gu C, Starnes L, Palladino F, Goga A, Kennedy S, L'Etoile ND.
Endogenous nuclear RNAi mediates behavioral adaptation to odor.
Cell 2013 154(5) 1010-1022
[ PubMed ID = 23993094 ]
[ RRC reference ]
|
Thivierge C, Makil N, Flamand M, Vasale JJ, Mello CC, Wohlschlegel J, Conte D Jr, Duchaine TF.
Tudor domain ERI-5 tethers an RNA-dependent RNA polymerase to DCR-1 to potentiate endo-RNAi.
Nat Struct Mol Biol 2011 19(1) 90-7
[ PubMed ID = 22179787 ]
[ RRC reference ]
|
Nakagawa A, Shi Y, Kage-Nakadai E, Mitani S, Xue D.
Caspase-dependent conversion of Dicer ribonuclease into a death-promoting deoxyribonuclease.
Science 2010 328(5976) 327-34
[ PubMed ID = 20223951 ]
[ RRC reference ]
|
Lu R, Yigit E, Li WX, Ding SW.
An RIG-I-Like RNA helicase mediates antiviral RNAi downstream of viral siRNA biogenesis in Caenorhabditis elegans.
PLoS Pathog 2009 5(2) e1000286
[ PubMed ID = 19197349 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.