分離済み変異体

tm1325

Allele Nametm1325
BalanceNot Required
OutCrossNot Accepted
Sequence NameC09B7.1
Gene Nameser-7
Worm BaseAllele Name tm1325
Gene Name ser-7
Sequence C09B7.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. R. Komuniecki: Genetics in press, Dr. K. Ashrafi: Cell Metab 7, 533 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 42634/42635-GGGAANNAAAACCCTCCCTNNANNANNATNNGGANNCC-43376/43377 (742 bp deletion + 38 bp insertion)
ChromosomeX
Putative gene structurejoin(36058..36389, 37087..37342, 40604..40933, 42388..42560, 43169..43306, 44163..44201, 44465..44504)
Map position-14.04
Balancer
Map position of balancer
Sequence of primersIntRev:CGCGGATTCTCTATCAATAG,ExtFwd:GGCCTGCCTTCCTGACATGT,IntFwd:ATCCTGGAGCTGGCGAGTTA,ExtRev:GACTGTAAACGCGCAGAGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Feng L, Marquina-Solis J, Yue L, Harnagel A, Greenfeld Y, Bargmann CI.
Context-dependent serotonin signaling links dietary quality to foraging decisions.
Nat Commun 2025 16(1) 10479 
[ PubMed ID = 41290599 ] [ RRC reference ]

White AM, Bauer AD, Faumont S, Lockery SR.
Behavioral and genetic analysis of the effects of the psychedelic 2,5-dimethoxy-4-iodoamphetamine (DOI) in C. elegans.
PLoS One 2025 20(8) e0329538 
[ PubMed ID = 40857291 ] [ RRC reference ]

Kim AT, Li S, Kim Y, You YJ, Park Y.
Food preference-based screening method for identification of effectors of substance use disorders using Caenorhabditis elegans.
Life Sci 2024 345 122580 
[ PubMed ID = 38514005 ] [ RRC reference ]

Dag U, Nwabudike I, Kang D, Gomes MA, Kim J, Atanas AA, Bueno E, Estrem C, Pugliese S, Wang Z, Towlson E, Flavell SW.
Dissecting the functional organization of the C. elegans serotonergic system at whole-brain scale.
Cell 2023 186(12) 2574-2592.e20 
[ PubMed ID = 37192620 ] [ RRC reference ]

Dag U, Nwabudike I, Kang D, Gomes MA, Kim J, Atanas AA, Bueno E, Estrem C, Pugliese S, Wang Z, Towlson E, Flavell SW.
Dissecting the Functional Organization of the C. elegans Serotonergic System at Whole-Brain Scale.
bioRxiv 2023   
[ PubMed ID = 36711891 ] [ RRC reference ]

Hernandez-Cravero B, Gallino S, Florman J, Vranych C, Diaz P, Elgoyhen AB, Alkema MJ, de Mendoza D.
Cannabinoids activate the insulin pathway to modulate mobilization of cholesterol in C. elegans.
PLoS Genet 2022 18(11) e1010346 
[ PubMed ID = 36346800 ] [ RRC reference ]

Emerson S, Hay M, Smith M, Granger R, Blauch D, Snyder N, El Bejjani R.
Acetylcholine signaling genes are required for cocaine-stimulated egg laying in Caenorhabditis elegans.
G3 (Bethesda) 2021 11(8)  
[ PubMed ID = 33914087 ] [ RRC reference ]

Khanna A, Sellegounder D, Kumar J, Chamoli M, Vargas M, Chinta SJ, Rane A, Nelson C, Peiris TH, Brem R, Andersen J, Lithgow G, Kapahi P.
Trimethylamine modulates dauer formation, neurodegeneration, and lifespan through tyra-3/daf-11 signaling in Caenorhabditis elegans.
Aging Cell 2021 20(5) e13351 
[ PubMed ID = 33819374 ] [ RRC reference ]

Chen YC, Seyedsayamdost MR, Ringstad N.
A microbial metabolite synergizes with endogenous serotonin to trigger C. elegans reproductive behavior.
Proc Natl Acad Sci U S A 2020 117(48) 30589-30598 
[ PubMed ID = 33199611 ] [ RRC reference ]

Crisford A, Calahorro F, Ludlow E, Marvin JMC, Hibbard JK, Lilley CJ, Kearn J, Keefe F, Johnson P, Harmer R, Urwin PE, O'Connor V, Holden-Dye L.
Identification and characterisation of serotonin signalling in the potato cyst nematode Globodera pallida reveals new targets for crop protection.
PLoS Pathog 2020 16(10) e1008884 
[ PubMed ID = 33007049 ] [ RRC reference ]

Oakes M, Law WJ, Komuniecki R.
Cannabinoids Stimulate the TRP Channel-Dependent Release of Both Serotonin and Dopamine to Modulate Behavior in C. elegans.
J Neurosci 2019 39(21) 4142-4152 
[ PubMed ID = 30886012 ] [ RRC reference ]

Perez-Gomez A, Carretero M, Weber N, Peterka V, To A, Titova V, Solis G, Osborn O, Petrascheck M.
A phenotypic Caenorhabditis elegans screen identifies a selective suppressor of antipsychotic-induced hyperphagia.
Nat Commun 2018 9(1) 5272 
[ PubMed ID = 30532051 ] [ RRC reference ]

Chew YL, Tanizawa Y, Cho Y, Zhao B, Yu AJ, Ardiel EL, Rabinowitch I, Bai J, Rankin CH, Lu H, Beets I, Schafer WR.
An Afferent Neuropeptide System Transmits Mechanosensory Signals Triggering Sensitization and Arousal in C. elegans.
Neuron 2018 99(6) 1233-1246.e6 
[ PubMed ID = 30146306 ] [ RRC reference ]

Bayer EA, Hobert O.
Past experience shapes sexually dimorphic neuronal wiring through monoaminergic signalling.
Nature 2018 561(7721) 117-121 
[ PubMed ID = 30150774 ] [ RRC reference ]

Zhang Q, Wu X, Chen P, Liu L, Xin N, Tian Y, Dillin A.
The Mitochondrial Unfolded Protein Response Is Mediated Cell-Non-autonomously by Retromer-Dependent Wnt Signaling.
Cell 2018 174(4) 870-883.e17 
[ PubMed ID = 30057120 ] [ RRC reference ]

Weeks JC, Roberts WM, Leasure C, Suzuki BM, Robinson KJ, Currey H, Wangchuk P, Eichenberger RM, Saxton AD, Bird TD, Kraemer BC, Loukas A, Hawdon JM, Caffrey CR, Liachko NF.
Sertraline, Paroxetine, and Chlorpromazine Are Rapidly Acting Anthelmintic Drugs Capable of Clinical Repurposing.
Sci Rep 2018 8(1) 975 
[ PubMed ID = 29343694 ] [ RRC reference ]

Stern S, Kirst C, Bargmann CI.
Neuromodulatory Control of Long-Term Behavioral Patterns and Individuality across Development.
Cell 2017 171(7) 1649-1662.e10 
[ PubMed ID = 29198526 ] [ RRC reference ]

Churgin MA, McCloskey RJ, Peters E, Fang-Yen C.
Antagonistic Serotonergic and Octopaminergic Neural Circuits Mediate Food-Dependent Locomotory Behavior in Caenorhabditis elegans.
J Neurosci 2017 37(33) 7811-7823 
[ PubMed ID = 28698386 ] [ RRC reference ]

Lee KS, Iwanir S, Kopito RB, Scholz M, Calarco JA, Biron D, Levine E.
Serotonin-dependent kinetics of feeding bursts underlie a graded response to food availability in C. elegans.
Nat Commun 2017 8 14221 
[ PubMed ID = 28145493 ] [ RRC reference ]

Lucanic M, Garrett T, Yu I, Calahorro F, Asadi Shahmirzadi A, Miller A, Gill MS, Hughes RE, Holden-Dye L, Lithgow GJ.
Chemical activation of a food deprivation signal extends lifespan.
Aging Cell 2016 15(5) 832-41 
[ PubMed ID = 27220516 ] [ RRC reference ]