Home > 分離済み変異体 > tm1320

分離済み変異体

Allele Name		tm1320
Allele Type		通常株
Sequence Name		ZK1128.8
Gene Name		vps-29
Worm Base	Allele Name	tm1320
	Gene Name	vps-29
	Sequence	ZK1128.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. G. Hermann: WT gut granules. Dr. H.C. Korswagen: QL and QR daughter cells, HSN migration defects, polarity of V5 division defects, similar to egl-20. Dr. S. Shaham: no obvious defects in glia development. Dr. H. Sawa: non-Psa.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		1190/1191-A-1731/1732 (541 bp deletion + 1 bp insertion)
Chromosome		III
Putative gene structure		complement(join(1289..1558, 1681..1825, 1874..2019, 2073..2075))
Map position		1.83
Balancer
Map position of balancer
Sequence of primers		IntFwd:CGACGCCAGTTTGACTGCCA,ExtFwd:CTTGCTCTGTAGGCCATCGA,IntRev:TGAACACAGGCTACGACGCT,ExtRev:TAACATGGGAATGCTCGCCT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Xie S, Dierlam C, Smith E, Duran R, Williams A, Davis A, Mathew D, Naslavsky N, Iyer J, Caplan S. The retromer complex regulates C. elegans development and mammalian ciliogenesis. J Cell Sci 2022 135(10)   [ PubMed ID = 35510502 ] [ RRC reference ] Tian Y, Kang Q, Shi X, Wang Y, Zhang N, Ye H, Xu Q, Xu T, Zhang R. SNX-3 mediates retromer-independent tubular endosomal recycling by opposing EEA-1-facilitated trafficking. PLoS Genet 2021 17(6) e1009607  [ PubMed ID = 34081703 ] [ RRC reference ] Zhang J, Liu J, Norris A, Grant BD, Wang X. A novel requirement for ubiquitin-conjugating enzyme UBC-13 in retrograde recycling of MIG-14/Wntless and Wnt signaling. Mol Biol Cell 2018 29(17) 2098-2112  [ PubMed ID = 29927348 ] [ RRC reference ] McGough IJ, de Groot REA, Jellett AP, Betist MC, Varandas KC, Danson CM, Heesom KJ, Korswagen HC, Cullen PJ. SNX3-retromer requires an evolutionary conserved MON2:DOPEY2:ATP9A complex to mediate Wntless sorting and Wnt secretion. Nat Commun 2018 9(1) 3737  [ PubMed ID = 30213940 ] [ RRC reference ] Zhang Q, Wu X, Chen P, Liu L, Xin N, Tian Y, Dillin A. The Mitochondrial Unfolded Protein Response Is Mediated Cell-Non-autonomously by Retromer-Dependent Wnt Signaling. Cell 2018 174(4) 870-883.e17  [ PubMed ID = 30057120 ] [ RRC reference ] Martínez-Velázquez LA, Ringstad N. Antagonistic regulation of trafficking to Caenorhabditis elegans sensory cilia by a Retinal Degeneration 3 homolog and retromer. Proc Natl Acad Sci U S A 2018 115(3) E438-E447  [ PubMed ID = 29282322 ] [ RRC reference ] Chen D, Xiao H, Zhang K, Wang B, Gao Z, Jian Y, Qi X, Sun J, Miao L, Yang C. Retromer is required for apoptotic cell clearance by phagocytic receptor recycling. Science 2010 327(5970) 1261-4  [ PubMed ID = 20133524 ] [ RRC reference ] Oikonomou G, Perens EA, Lu Y, Shaham S. Some, but not all, retromer components promote morphogenesis of C. elegans sensory compartments. Dev Biol 2012 362(1) 42-9  [ PubMed ID = 22138055 ] [ RRC reference ] Harterink M, Port F, Lorenowicz MJ, McGough IJ, Silhankova M, Betist MC, van Weering JRT, van Heesbeen RGHP, Middelkoop TC, Basler K, Cullen PJ, Korswagen HC. A SNX3-dependent retromer pathway mediates retrograde transport of the Wnt sorting receptor Wntless and is required for Wnt secretion. Nat Cell Biol 2011 13(8) 914-923  [ PubMed ID = 21725319 ] [ RRC reference ] Lorenowicz MJ, Macurkova M, Harterink M, Middelkoop TC, de Groot R, Betist MC, Korswagen HC. Inhibition of late endosomal maturation restores Wnt secretion in Caenorhabditis elegans vps-29 retromer mutants. Cell Signal 2014 26(1) 19-31  [ PubMed ID = 24056045 ] [ RRC reference ] Dang H, Klokk TI, Schaheen B, McLaughlin BM, Thomas AJ, Durns TA, Bitler BG, Sandvig K, Fares H. Derlin-dependent retrograde transport from endosomes to the Golgi apparatus. Traffic 2011 12(10) 1417-31  [ PubMed ID = 21722281 ] [ RRC reference ] de Groot RE, Ganji RS, Bernatik O, Lloyd-Lewis B, Seipel K, Šedová K, Zdráhal Z, Dhople VM, Dale TC, Korswagen HC, Bryja V. Huwe1-mediated ubiquitylation of dishevelled defines a negative feedback loop in the Wnt signaling pathway. Sci Signal 2014 7(317) ra26  [ PubMed ID = 24643799 ] [ RRC reference ] de Groot RE, Rappel SB, Lorenowicz MJ, Korswagen HC. Protein kinase CK2 is required for Wntless internalization and Wnt secretion. Cell Signal 2014 26(12) 2601-5  [ PubMed ID = 25178265 ] [ RRC reference ] Bai Z, Grant BD. A TOCA/CDC-42/PAR/WAVE functional module required for retrograde endocytic recycling. Proc Natl Acad Sci U S A 2015 112(12) E1443-52  [ PubMed ID = 25775511 ] [ RRC reference ] Ji N, Middelkoop TC, Mentink RA, Betist MC, Tonegawa S, Mooijman D, Korswagen HC, van Oudenaarden A. Feedback control of gene expression variability in the Caenorhabditis elegans Wnt pathway. Cell 2013 155(4) 869-80  [ PubMed ID = 24209624 ] [ RRC reference ] Cruciat CM, Dolde C, de Groot RE, Ohkawara B, Reinhard C, Korswagen HC, Niehrs C. RNA helicase DDX3 is a regulatory subunit of casein kinase 1 in Wnt-β-catenin signaling. Science 2013 339(6126) 1436-41  [ PubMed ID = 23413191 ] [ RRC reference ] Lu N, Shen Q, Mahoney TR, Liu X, Zhou Z. Three sorting nexins drive the degradation of apoptotic cells in response to PtdIns(3)P signaling. Mol Biol Cell 2011 22(3) 354-74  [ PubMed ID = 21148288 ] [ RRC reference ] Wassmer T, Attar N, Harterink M, van Weering JR, Traer CJ, Oakley J, Goud B, Stephens DJ, Verkade P, Korswagen HC, Cullen PJ. The retromer coat complex coordinates endosomal sorting and dynein-mediated transport, with carrier recognition by the trans-Golgi network. Dev Cell 2009 17(1) 110-22  [ PubMed ID = 19619496 ] [ RRC reference ] Prasad BC, Clark SG. Wnt signaling establishes anteroposterior neuronal polarity and requires retromer in C. elegans. Development 2006 133(9) 1757-66  [ PubMed ID = 16571624 ] [ RRC reference ] Coudreuse DY, Roël G, Betist MC, Destrée O, Korswagen HC. Wnt gradient formation requires retromer function in Wnt-producing cells. Science 2006 312(5775) 921-4  [ PubMed ID = 16645052 ] [ RRC reference ]