Allele Name | tm1310 |
Allele Type | バランス済 |
Sequence Name | C16A3.8 |
Gene Name | thoc-2 |
Worm Base | Allele Name |
tm1310
|
Gene Name |
thoc-2
|
Sequence |
C16A3.8
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 1472/1473-2161/2162 (689 bp deletion) |
Chromosome | III |
Putative gene structure | join(45..140, 189..320, 522..613, 660..879, 1100..1282, 1333..1485, 1534..2038, 2267..2668, 2874..3801, 3850..3958, 4001..4139, 4188..5047, 5103..5483, 5550..5771) |
Map position | -1.35 |
Balancer | hT2 |
Map position of balancer | |
Sequence of primers | IntRev:TTCCAAGAGCTTGCAGCCAA,ExtFwd:GCTTATGGAAGCAGCCGAGA,IntFwd:GCTCAGCGAATGAGAATGAA,ExtRev:GAGATCCAACCAGTGTTCCA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Sun B, Sherrin M, Roy R. Unscheduled epigenetic modifications cause genome instability and sterility through aberrant R-loops following starvation. Nucleic Acids Res 2023 51(1) 84-98
[ PubMed ID = 36504323 ]
[ RRC reference ]
|
Castellano-Pozo M, García-Muse T, Aguilera A. The Caenorhabditis elegans THO complex is required for the mitotic cell cycle and development. PLoS One 2012 7(12) e52447
[ PubMed ID = 23285047 ]
[ RRC reference ]
|
Castellano-Pozo M, García-Muse T, Aguilera A. R-loops cause replication impairment and genome instability during meiosis. EMBO Rep 2012 13(10) 923-9
[ PubMed ID = 22878416 ]
[ RRC reference ]
|
Castellano-Pozo M, Santos-Pereira JM, Rondón AG, Barroso S, Andújar E, Pérez-Alegre M, García-Muse T, Aguilera A. R loops are linked to histone H3 S10 phosphorylation and chromatin condensation. Mol Cell 2013 52(4) 583-90
[ PubMed ID = 24211264 ]
[ RRC reference ]
|
|