分離済み変異体

tm1298

Allele Nametm1298
BalanceNot Required
OutCrossNot Accepted
Sequence NameY41E3.9
Gene Namefcd-2
Worm BaseAllele Name tm1298
Gene Name fcd-2
Sequence Y41E3.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H-S. Koo: bag of worms, slow larval growth. Early embryos are slightly more sensitive to ionizing radiation but germ cells show higher resistance to ionizing radiation. Dr. S. Boulton: DNA repair in press. Dr. H-S. Koo: BBRC 352, 479 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 81469/81470-81706/81707 (237 bp deletion)
ChromosomeIV
Putative gene structurejoin(75699..76652, 77499..77630, 79122..79749, 80673..81104, 81682..82102, 82676..82737, 82789..82942, 83342..83607, 84270..84940, 86000..86200)
Map position12.83
Balancer
Map position of balancer
Sequence of primersExtFwd:GCGGGAGTTGAGACGCGTAT,IntRev:CAGCTAACAACATTGGTGGT,ExtRev:GTCCGCCCCAAATCACCTCA,IntFwd:CCTGACTCCACATGCCACTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Verschuren J, van Schendel R, van Bostelen I, Verkennis AEE, Knipscheer P, Tijsterman M.
FAN1-mediated translesion synthesis and POLQ/HELQ-mediated end joining generate interstrand crosslink-induced mutations.
Nat Commun 2025 16(1) 2495 
[ PubMed ID = 40082407 ] [ RRC reference ]

Ananthaswamy D, Funes K, Borges T, Roques S, Fassnacht N, Jamal SE, Checchi PM, Wei-Sy Lee T.
NuRD chromatin remodeling is required to repair exogenous DSBs in the Caenorhabditis elegans germline.
bioRxiv 2024   
[ PubMed ID = 39314477 ] [ RRC reference ]

Rieckher M, Gallrein C, Alquezar-Artieda N, Bourached-Silva N, Vaddavalli PL, Mares D, Backhaus M, Blindauer T, Greger K, Wiesner E, Pontel LB, Schumacher B.
Distinct DNA repair mechanisms prevent formaldehyde toxicity during development, reproduction and aging.
Nucleic Acids Res 2024 52(14) 8271-8285 
[ PubMed ID = 38894680 ] [ RRC reference ]

Silva N, Castellano-Pozo M, Matsuzaki K, Barroso C, Roman-Trufero M, Craig H, Brooks DR, Isaac RE, Boulton SJ, Martinez-Perez E.
Proline-specific aminopeptidase P prevents replication-associated genome instability.
PLoS Genet 2022 18(1) e1010025 
[ PubMed ID = 35081133 ] [ RRC reference ]

Deng X, Tchieu J, Higginson DS, Hsu KS, Feldman R, Studer L, Shaham S, Powell SN, Fuks Z, Kolesnick R.
Disabling the Fanconi Anemia Pathway in Stem Cells Leads to Radioresistance and Genomic Instability.
Cancer Res 2021 81(13) 3706-3716 
[ PubMed ID = 33941615 ] [ RRC reference ]

Dello Stritto MR, Bauer B, Barraud P, Jantsch V.
DNA topoisomerase 3 is required for efficient germ cell quality control.
J Cell Biol 2021 220(6)  
[ PubMed ID = 33798260 ] [ RRC reference ]

Ye FB, Hamza A, Singh T, Flibotte S, Hieter P, O'Neil NJ.
A Multimodal Genotoxic Anticancer Drug Characterized by Pharmacogenetic Analysis in Caenorhabditis elegans.
Genetics 2020 215(3) 609-621 
[ PubMed ID = 32414869 ] [ RRC reference ]

Germoglio M, Valenti A, Gallo I, Forenza C, Santonicola P, Silva N, Adamo A.
In vivo analysis of FANCD2 recruitment at meiotic DNA breaks in Caenorhabditis elegans.
Sci Rep 2020 10(1) 103 
[ PubMed ID = 31919410 ] [ RRC reference ]

Kim HM, Beese-Sims SE, Colaiácovo MP.
Fanconi Anemia FANCM/FNCM-1 and FANCD2/FCD-2 Are Required for Maintaining Histone Methylation Levels and Interact with the Histone Demethylase LSD1/SPR-5 in Caenorhabditis elegans.
Genetics 2018 209(2) 409-423 
[ PubMed ID = 29588287 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

van Schendel R, van Heteren J, Welten R, Tijsterman M.
Genomic Scars Generated by Polymerase Theta Reveal the Versatile Mechanism of Alternative End-Joining.
PLoS Genet 2016 12(10) e1006368 
[ PubMed ID = 27755535 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9 
[ PubMed ID = 24768858 ] [ RRC reference ]

Silva N, Adamo A, Santonicola P, Martinez-Perez E, La Volpe A.
Pro-crossover factors regulate damage-dependent apoptosis in the Caenorhabditis elegans germ line.
Cell Death Differ 2013 20(9) 1209-18 
[ PubMed ID = 23832114 ] [ RRC reference ]

Lee H, Alpi AF, Park MS, Rose A, Koo HS.
C. elegans ring finger protein RNF-113 is involved in interstrand DNA crosslink repair and interacts with a RAD51C homolog.
PLoS One 2013 8(3) e60071 
[ PubMed ID = 23555887 ] [ RRC reference ]

Adamo A, Woglar A, Silva N, Penkner A, Jantsch V, La Volpe A.
Transgene-mediated cosuppression and RNA interference enhance germ-line apoptosis in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2012 109(9) 3440-5 
[ PubMed ID = 22331911 ] [ RRC reference ]

Adamo A, Collis SJ, Adelman CA, Silva N, Horejsi Z, Ward JD, Martinez-Perez E, Boulton SJ, La Volpe A.
Preventing nonhomologous end joining suppresses DNA repair defects of Fanconi anemia.
Mol Cell 2010 39(1) 25-35 
[ PubMed ID = 20598602 ] [ RRC reference ]

Lee KY, Chung KY, Koo HS.
The involvement of FANCM, FANCI, and checkpoint proteins in the interstrand DNA crosslink repair pathway is conserved in C. elegans.
DNA Repair (Amst) 2010 9(4) 374-82 
[ PubMed ID = 20075016 ] [ RRC reference ]

Youds JL, Barber LJ, Boulton SJ.
C. elegans: a model of Fanconi anemia and ICL repair.
Mutat Res 2009 668(1-2) 103-16 
[ PubMed ID = 19059419 ] [ RRC reference ]

Muzzini DM, Plevani P, Boulton SJ, Cassata G, Marini F.
Caenorhabditis elegans POLQ-1 and HEL-308 function in two distinct DNA interstrand cross-link repair pathways.
DNA Repair (Amst) 2008 7(6) 941-50 
[ PubMed ID = 18472307 ] [ RRC reference ]

Youds JL, Barber LJ, Ward JD, Collis SJ, O'Neil NJ, Boulton SJ, Rose AM.
DOG-1 is the Caenorhabditis elegans BRIP1/FANCJ homologue and functions in interstrand cross-link repair.
Mol Cell Biol 2008 28(5) 1470-9 
[ PubMed ID = 18086896 ] [ RRC reference ]