| Allele Name | tm1297 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F29C4.6 |
| Gene Name | tut-1 |
| Worm Base | Allele Name |
tm1297
|
| Gene Name |
tut-1
|
| Sequence |
F29C4.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. R. Plasterk: reduced brood size, sterile at 25C. Dr. M. Peter: Nature 458, 228 (2009). Dr. A. Bystrom: PLoS Genetics 5, e1000561 (2009) |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 10824/10825-G-11650/11651 (826 bp deletion + 1 bp insertion) |
| Chromosome | IV |
| Putative gene structure | complement(join(9653..9902, 10621..11327, 11781..11945)) |
| Map position | -26.96 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CAACGTCGGCATTTCGACCT,ExtRev:GACAAGCTGGCATCATGTAG,IntRev:TAACCGTACCCGGCGGCATT,IntFwd:CGATAGGCATTCGGTGCGTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Meyer DH, Schumacher B.
BiT age: A transcriptome-based aging clock near the theoretical limit of accuracy.
Aging Cell 2021 20(3) e13320
[ PubMed ID = 33656257 ]
[ RRC reference ]
|
Fernandes De Abreu DA, Salinas-Giegé T, Drouard L, Remy JJ.
Alanine tRNAs Translate Environment Into Behavior in Caenorhabditis elegans.
Front Cell Dev Biol 2020 8 571359
[ PubMed ID = 33195203 ]
[ RRC reference ]
|
Kawamura K, Maruyama IN.
Forward Genetic Screen for Caenorhabditis elegans Mutants with a Shortened Locomotor Healthspan.
G3 (Bethesda) 2019 9(8) 2415-2423
[ PubMed ID = 31213517 ]
[ RRC reference ]
|
Nedialkova DD, Leidel SA.
Optimization of Codon Translation Rates via tRNA Modifications Maintains Proteome Integrity.
Cell 2015 161(7) 1606-18
[ PubMed ID = 26052047 ]
[ RRC reference ]
|
Chen C, Tuck S, Byström AS.
Defects in tRNA modification associated with neurological and developmental dysfunctions in Caenorhabditis elegans elongator mutants.
PLoS Genet 2009 5(7) e1000561
[ PubMed ID = 19593383 ]
[ RRC reference ]
|
Leidel S, Pedrioli PG, Bucher T, Brost R, Costanzo M, Schmidt A, Aebersold R, Boone C, Hofmann K, Peter M.
Ubiquitin-related modifier Urm1 acts as a sulphur carrier in thiolation of eukaryotic transfer RNA.
Nature 2009 458(7235) 228-32
[ PubMed ID = 19145231 ]
[ RRC reference ]
|
Dewez M, Bauer F, Dieu M, Raes M, Vandenhaute J, Hermand D.
The conserved Wobble uridine tRNA thiolase Ctu1-Ctu2 is required to maintain genome integrity.
Proc Natl Acad Sci U S A 2008 105(14) 5459-64
[ PubMed ID = 18391219 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.