分離済み変異体

tm1275

Allele Nametm1275
BalanceNot Required
OutCrossNot Accepted
Sequence NameW09D10.2
Gene Nametat-3
Worm BaseAllele Name tm1275
Gene Name tat-3
Sequence W09D10.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. Tuck: no obvious defects in endocytosis. Dr. M. Han: normal growth rate.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 21820/21822-ANACAGA-22267/22268 (446 bp deletion + 7 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(15836..15856, 16246..16334, 16406..16541, 17071..17337, 17514..17966, 18591..19433, 19944..20213, 20484..21140, 21294..21491, 21546..22016, 22109..22711))
Map position5.05
Balancer
Map position of balancer
Sequence of primersExtFwd:CGGACGACCTCCATAGTCAT,IntFwd:ACTGAGCATCGGCGGAATAC,ExtRev:CTCATTATGGGTACCCCCGA,IntRev:GTACCCCCGACACGGTAATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nilsson L, Jonsson E, Tuck S.
Caenorhabditis elegans numb inhibits endocytic recycling by binding TAT-1 aminophospholipid translocase.
Traffic 2011 12(12) 1839-49 
[ PubMed ID = 21917090 ] [ RRC reference ]

Seamen E, Blanchette JM, Han M.
P-type ATPase TAT-2 negatively regulates monomethyl branched-chain fatty acid mediated function in post-embryonic growth and development in C. elegans.
PLoS Genet 2009 5(8) e1000589 
[ PubMed ID = 19662161 ] [ RRC reference ]

Lyssenko NN, Miteva Y, Gilroy S, Hanna-Rose W, Schlegel RA.
An unexpectedly high degree of specialization and a widespread involvement in sterol metabolism among the C. elegans putative aminophospholipid translocases.
BMC Dev Biol 2008 8 96 
[ PubMed ID = 18831765 ] [ RRC reference ]

Darland-Ransom M, Wang X, Sun CL, Mapes J, Gengyo-Ando K, Mitani S, Xue D.
Role of C. elegans TAT-1 protein in maintaining plasma membrane phosphatidylserine asymmetry.
Science 2008 320(5875) 528-31 
[ PubMed ID = 18436785 ] [ RRC reference ]