| Allele Name | tm12527 |
| Balance | Not Required |
| OutCross | Request Available |
| Sequence Name | Y70G10A.2 |
| Gene Name | Y70G10A.2 |
| Worm Base | Allele Name |
tm12527
|
| Gene Name |
Y70G10A.2
|
| Sequence |
Y70G10A.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 11592/11593-11688/11689(96 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(8774..8903, 8953..9193, 9252..9577, 9639..9708, 9755..9943, 9999..10320, 10377..10527, 11023..11289, 11333..11691, 11739..12599, 12702..14102, 14450..14557, 14614..14689)) |
| Map position | 2.02 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:TCGTCCTCTTCTTCCACAAG,ExtFwd:TACAGGGATTTGATGCTCTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Nikonorova IA, desRanleau E, Jacobs KC, Saul J, Walsh JD, Wang J, Barr MM.
Polycystins recruit cargo to distinct ciliary extracellular vesicle subtypes in C. elegans.
Nat Commun 2025 16(1) 2899
[ PubMed ID = 40180912 ]
[ RRC reference ]
|
Nikonorova IA, desRanleau E, Jacobs KC, Saul J, Walsh JD, Wang J, Barr MM.
Polycystins recruit cargo to distinct ciliary extracellular vesicle subtypes.
bioRxiv 2024
[ PubMed ID = 38659811 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.