| Allele Name | tm1250 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | F35C8.4 |
| Gene Name | syn-1 |
| Worm Base | Allele Name |
tm1250
(x1) |
| Gene Name |
syn-1
|
| Sequence |
F35C8.4
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 987/988-1662/1663 (675 bp deletion) |
| Chromosome | X |
| Putative gene structure | join(92..121, 585..692, 1123..1309, 1357..1533, 1899..2110, 2785..2991) |
| Map position | -5.63 |
| Balancer | egl-13 (n483) X |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CCCTGTTCTGAGGGTACTCA,IntFwd:TGACGTGGAATCCCAACCTT,ExtRev:ATGCAGGTCCAGGTGGGAGA,IntRev:GTCGAAACATAGCTCCTCTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Otarigho B, Butts AF, Aballay A.
Neuronal NPR-15 modulates molecular and behavioral immune responses via the amphid sensory neuron-intestinal axis in C. elegans.
Elife 2024 12
[ PubMed ID = 38446031 ]
[ RRC reference ]
|
Cebul ER, Marivin A, Wexler LR, Perrat PN, Bénard CY, Garcia-Marcos M, Heiman MG.
SAX-7/L1CAM acts with the adherens junction proteins MAGI-1, HMR-1/Cadherin, and AFD-1/Afadin to promote glial-mediated dendrite extension.
bioRxiv 2024
[ PubMed ID = 38260503 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.