| Allele Name | tm1246 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | ZK430.3 |
| Gene Name | sod-5 |
| Worm Base | Allele Name |
tm1246
|
| Gene Name |
sod-5
|
| Sequence |
ZK430.3
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009). |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 24062/24063-24523/24524 (461 bp deletion) |
| Chromosome | II |
| Putative gene structure | join(24739..24780, 24892..24975, 25564..25722, 25771..25924, 25970..26067) |
| Map position | -4.69 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GATCGACGTGGACAACCATG,ExtRev:GGCCTTGTCGTCGATTCCCT,IntFwd:GCATCTGCCTTGTCGTGGAT,ExtFwd:AATGGCGGAAGGATAGCATC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Desjardins D, Cacho-Valadez B, Liu JL, Wang Y, Yee C, Bernard K, Khaki A, Breton L, Hekimi S.
Antioxidants reveal an inverted U-shaped dose-response relationship between reactive oxygen species levels and the rate of aging in Caenorhabditis elegans.
Aging Cell 2017 16(1) 104-112
[ PubMed ID = 27683245 ]
[ RRC reference ]
|
Schaar CE, Dues DJ, Spielbauer KK, Machiela E, Cooper JF, Senchuk M, Hekimi S, Van Raamsdonk JM.
Mitochondrial and cytoplasmic ROS have opposing effects on lifespan.
PLoS Genet 2015 11(2) e1004972
[ PubMed ID = 25671321 ]
[ RRC reference ]
|
Van Raamsdonk JM, Hekimi S.
Superoxide dismutase is dispensable for normal animal lifespan.
Proc Natl Acad Sci U S A 2012 109(15) 5785-90
[ PubMed ID = 22451939 ]
[ RRC reference ]
|
Van Raamsdonk JM, Hekimi S.
Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans.
PLoS Genet 2009 5(2) e1000361
[ PubMed ID = 19197346 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.