分離済み変異体

tm1246

Allele Nametm1246
BalanceNot Required
OutCrossNot Accepted
Sequence NameZK430.3
Gene Namesod-5
Worm BaseAllele Name tm1246
Gene Name sod-5
Sequence ZK430.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 24062/24063-24523/24524 (461 bp deletion)
ChromosomeII
Putative gene structurejoin(24739..24780, 24892..24975, 25564..25722, 25771..25924, 25970..26067)
Map position-4.69
Balancer
Map position of balancer
Sequence of primersIntRev:GATCGACGTGGACAACCATG,ExtRev:GGCCTTGTCGTCGATTCCCT,IntFwd:GCATCTGCCTTGTCGTGGAT,ExtFwd:AATGGCGGAAGGATAGCATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Desjardins D, Cacho-Valadez B, Liu JL, Wang Y, Yee C, Bernard K, Khaki A, Breton L, Hekimi S.
Antioxidants reveal an inverted U-shaped dose-response relationship between reactive oxygen species levels and the rate of aging in Caenorhabditis elegans.
Aging Cell 2017 16(1) 104-112 
[ PubMed ID = 27683245 ] [ RRC reference ]

Schaar CE, Dues DJ, Spielbauer KK, Machiela E, Cooper JF, Senchuk M, Hekimi S, Van Raamsdonk JM.
Mitochondrial and cytoplasmic ROS have opposing effects on lifespan.
PLoS Genet 2015 11(2) e1004972 
[ PubMed ID = 25671321 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Superoxide dismutase is dispensable for normal animal lifespan.
Proc Natl Acad Sci U S A 2012 109(15) 5785-90 
[ PubMed ID = 22451939 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans.
PLoS Genet 2009 5(2) e1000361 
[ PubMed ID = 19197346 ] [ RRC reference ]