分離済み変異体

tm1238

Allele Nametm1238
BalanceNot Required
OutCrossNot Accepted
Sequence NameF39H11.3
Gene Namecdk-8
Worm BaseAllele Name tm1238
Gene Name cdk-8
Sequence F39H11.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Sawa: Dpy, fertile, low brood size., 16%Psa, very weak Muv (2%). Dr. T. Schedl: could not maintain mutants. Dr. J. Kimble: homozygous viable and fertile. Dr. J. Lee: short body length. Dr. R. Mako Saito: Dev Biol 313, :603 (2008).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 8004/8005-8731/8732 (727 bp deletion)
ChromosomeI
Putative gene structurejoin(8040..8044, 8094..8333, 8458..8645, 8697..8793, 8843..8978, 9025..9146, 9197..9295, 9677..9836, 9885..10382, 10833..11156)
Map position3.01
Balancer
Map position of balancer
Sequence of primersExtRev:GCCCTTACCGTCATCTGCTG,IntRev:CGTCAGTCTCCCTTGGTGGT,ExtFwd:CCTGCCGTTTGCACATACGT,IntFwd:GTTCGGCGAGAATTTGCCAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Besnard F, Picao-Osorio J, Dubois C, Félix MA.
A broad mutational target explains a fast rate of phenotypic evolution.
Elife 2020 9  
[ PubMed ID = 32851977 ] [ RRC reference ]

Shomer N, Kadhim AZ, Grants JM, Cheng X, Alhusari D, Bhanshali F, Poon AF, Lee MYY, Muhuri A, Park JI, Shih J, Lee D, Lee SV, Lynn FC, Taubert S.
Mediator subunit MDT-15/MED15 and Nuclear Receptor HIZR-1/HNF4 cooperate to regulate toxic metal stress responses in Caenorhabditis elegans.
PLoS Genet 2019 15(12) e1008508 
[ PubMed ID = 31815936 ] [ RRC reference ]

Underwood RS, Deng Y, Greenwald I.
Integration of EGFR and LIN-12/Notch Signaling by LIN-1/Elk1, the Cdk8 Kinase Module, and SUR-2/Med23 in Vulval Precursor Cell Fate Patterning in Caenorhabditis elegans.
Genetics 2017 207(4) 1473-1488 
[ PubMed ID = 28954762 ] [ RRC reference ]

Luo S, Horvitz HR.
The CDK8 Complex and Proneural Proteins Together Drive Neurogenesis from a Mesodermal Lineage.
Curr Biol 2017 27(5) 661-672 
[ PubMed ID = 28238659 ] [ RRC reference ]

Grants JM, Ying LT, Yoda A, You CC, Okano H, Sawa H, Taubert S.
The Mediator Kinase Module Restrains Epidermal Growth Factor Receptor Signaling and Represses Vulval Cell Fate Specification in Caenorhabditis elegans.
Genetics 2016 202(2) 583-99 
[ PubMed ID = 26715664 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J Neurosci 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]

Lee K, Shim J, Lee J, Lee J.
Identification of genes interacting with rnt-1 through large-scale RNAi screening in Caenorhabditis elegans.
G3 (Bethesda) 2013 3(10) 1779-84 
[ PubMed ID = 23979934 ] [ RRC reference ]

Steimel A, Suh J, Hussainkhel A, Deheshi S, Grants JM, Zapf R, Moerman DG, Taubert S, Hutter H.
The C. elegans CDK8 Mediator module regulates axon guidance decisions in the ventral nerve cord and during dorsal axon navigation.
Dev Biol 2013 377(2) 385-98 
[ PubMed ID = 23458898 ] [ RRC reference ]

Ou CY, Poon VY, Maeder CI, Watanabe S, Lehrman EK, Fu AK, Park M, Fu WY, Jorgensen EM, Ip NY, Shen K.
Two cyclin-dependent kinase pathways are essential for polarized trafficking of presynaptic components.
Cell 2010 141(5) 846-58 
[ PubMed ID = 20510931 ] [ RRC reference ]

Clayton JE, van den Heuvel SJ, Saito RM.
Transcriptional control of cell-cycle quiescence during C. elegans development.
Dev Biol 2008 313(2) 603-13 
[ PubMed ID = 18082681 ] [ RRC reference ]