分離済み変異体

tm1233

Allele Nametm1233
BalanceNot Required
OutCrossNot Accepted
Sequence NameF42A6.9
Gene Nameelks-1
Worm BaseAllele Name tm1233
Gene Name elks-1
Sequence F42A6.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. K. Shen: HSN presynaptic vesicle localization normal. HSN presynaptic components (syd-2, syd-1, GIT-1, SAD-1) localization normal. Dr. Y. Jin: same as reported by Denken et al.(2005). Dr. M. Zhen: no SYD-2::GFP localization defects in GABAergic neurons. Dr. C. Bargmann: locomotion OK, normal GFP::UNC-2 localization.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 27776/27777-28341/28342 (565 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(24955..25102, 25160..25275, 26060..26429, 26702..27734, 28115..28223, 28272..28460))
Map position-4.61
Balancer
Map position of balancer
Sequence of primersExtRev:GCCTACCTGGGATGATACGA,IntRev:CTGGGATGATACGATGGTCT,ExtFwd:CTCGTCTCAGCTCATCGGTA,IntFwd:CAGCTCATCGGTACCCTTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Frankel EB, Tiroumalechetty A, Su Z, Henry PS, Mueller BD, Jorgensen EM, Wu Y, Kurshan PT.
Intracellular protein-lipid interactions drive presynaptic assembly prior to neurexin recruitment.
Neuron 2025 113(5) 737-753.e6 
[ PubMed ID = 39814011 ] [ RRC reference ]

Chia PH, Patel MR, Shen K.
NAB-1 instructs synapse assembly by linking adhesion molecules and F-actin to active zone proteins.
Nat Neurosci 2012 15(2) 234-42 
[ PubMed ID = 22231427 ] [ RRC reference ]

Saheki Y, Bargmann CI.
Presynaptic CaV2 calcium channel traffic requires CALF-1 and the alpha(2)delta subunit UNC-36.
Nat Neurosci 2009 12(10) 1257-65 
[ PubMed ID = 19718034 ] [ RRC reference ]

Patel MR, Shen K.
RSY-1 is a local inhibitor of presynaptic assembly in C. elegans.
Science 2009 323(5920) 1500-3 
[ PubMed ID = 19286562 ] [ RRC reference ]

Patel MR, Lehrman EK, Poon VY, Crump JG, Zhen M, Bargmann CI, Shen K.
Hierarchical assembly of presynaptic components in defined C. elegans synapses.
Nat Neurosci 2006 9(12) 1488-98 
[ PubMed ID = 17115039 ] [ RRC reference ]