| Allele Name | tm1203 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | R07E5.8 |
| Gene Name | cku-80 |
| Worm Base | Allele Name |
tm1203
|
| Gene Name |
cku-80
|
| Sequence |
R07E5.8
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable.Dr. T. Schedl: could not recover mutants. Dr. S. Ahmed: Genetics 173, 1301-1317 (2006). Dr. J-L. Bessereau: in frame deletion and no phenotype. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 27310/27311-27901/27902 (591 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(26798..26938, 26986..27181, 27231..27408, 27455..27538, 27861..27933, 27984..28394, 28840..29155, 29208..29268, 29314..29399, 29453..29871, 29924..30056, 30110..30198) |
| Map position | -3.17 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TGACGGTGAACTGTCCGCGT,IntFwd:ACTGTCCGCGTGCACCAGAT,ExtRev:ACATTCTCCGTCGTTGCGAG,IntRev:TAGCACTCCACCAGTCTGTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Suehiro Y, Yoshina S, Motohashi T, Iwata S, Dejima K, Mitani S. Efficient collection of a large number of mutations by mutagenesis of DNA damage response defective animals. Sci Rep 2021 11(1) 7630
[ PubMed ID = 33828169 ]
[ RRC reference ]
|
Vujin A, Jones SJ, Zetka M. NHJ-1 Is Required for Canonical Nonhomologous End Joining in Caenorhabditis elegans. Genetics 2020 215(3) 635-651
[ PubMed ID = 32457132 ]
[ RRC reference ]
|
Li X, O'Neil NJ, Moshgabadi N, Hieter P. Synthetic cytotoxicity: digenic interactions with TEL1/ATM mutations reveal sensitivity to low doses of camptothecin. Genetics 2014 197(2) 611-23
[ PubMed ID = 24653001 ]
[ RRC reference ]
|
Lowden MR, Meier B, Lee TW, Hall J, Ahmed S. End joining at Caenorhabditis elegans telomeres. Genetics 2008 180(2) 741-54
[ PubMed ID = 18780750 ]
[ RRC reference ]
|
Clejan I, Boerckel J, Ahmed S. Developmental modulation of nonhomologous end joining in Caenorhabditis elegans. Genetics 2006 173(3) 1301-17
[ PubMed ID = 16702421 ]
[ RRC reference ]
|
|