分離済み変異体

tm1195

Allele Name

tm1195

Balance

Not Required

OutCross

Not Accepted

Sequence Name

K12B6.1

Gene Name

sago-1

Worm Base

Allele Name

tm1195

Gene Name

sago-1

Sequence

K12B6.1

Phenotype

homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).

Mutation site

27251/27252-27672/27673 (421 bp deletion)

Chromosome

Putative gene structure

join(26237..26396, 26448..26701, 26847..27049, 27100..27272, 27325..27450, 27796..28106, 28153..28439, 28493..28586, 28730..28918, 28969..29079, 29125..29214, 29259..29510, 29851..30027, 30078..30199, 30277..30373)

Map position

-0.19

Balancer

Map position of balancer

Sequence of primers

IntRev:CGAGTCCAGTCACACTCTCT,ExtRev:CCGGTTTTGGAAGAACGAGT,IntFwd:AAGTCACCAGCAGCATGGCT,ExtFwd:CACAACACTCGCCATGTCCA

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ] [ RRC reference ]

Chen X, Wang K, Mufti FUD, Xu D, Zhu C, Huang X, Zeng C, Jin Q, Huang X, Yan YH, Dong MQ, Feng X, Shi Y, Kennedy S, Guang S.
Germ granule compartments coordinate specialized small RNA production.
Nat Commun 2024 15(1) 5799
[ PubMed ID = 38987544 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ] [ RRC reference ]

Dube F, Hinas A, Delhomme N, Åbrink M, Svärd S, Tydén E.
Transcriptomics of ivermectin response in Caenorhabditis elegans: Integrating abamectin quantitative trait loci and comparison to the Ivermectin-exposed DA1316 strain.
PLoS One 2023 18(5) e0285262
[ PubMed ID = 37141255 ] [ RRC reference ]

Watts JS, Harrison HF, Omi S, Guenthers Q, Dalelio J, Pujol N, Watts JL.
New Strains for Tissue-Specific RNAi Studies in Caenorhabditis elegans.
G3 (Bethesda) 2020 10(11) 4167-4176
[ PubMed ID = 32943454 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
mBio 2017 8(5)
[ PubMed ID = 29018118 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32
[ PubMed ID = 24532782 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19
[ PubMed ID = 23329696 ] [ RRC reference ]

Gu SG, Pak J, Guang S, Maniar JM, Kennedy S, Fire A.
Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.
Nat Genet 2012 44(2) 157-64
[ PubMed ID = 22231482 ] [ RRC reference ]

Corrêa RL, Steiner FA, Berezikov E, Ketting RF.
MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.
PLoS Genet 2010 6(4) e1000903
[ PubMed ID = 20386745 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc Natl Acad Sci U S A 2010 107(8) 3582-7
[ PubMed ID = 20133583 ] [ RRC reference ]

Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC.
Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi.
Cell 2006 127(4) 747-57
[ PubMed ID = 17110334 ] [ RRC reference ]