分離済み変異体

tm1183

Allele Nametm1183
BalanceNot Required
OutCrossNot Accepted
Sequence NameF56A3.5
Gene Namebro-1
Worm BaseAllele Name tm1183
Gene Name bro-1
Sequence F56A3.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16215/16216-16981/16982 (766 bp deletion)
ChromosomeI
Putative gene structurejoin(15956..16120, 16553..16618, 17360..17587)
Map position-0.3
Balancer
Map position of balancer
Sequence of primersExtRev:CCGTTCAATTCACGAAGCAT,IntRev:GGACCTGCGAGTTGTAACAA,IntFwd:CCGACAACATTTGTCGGTGA,ExtFwd:TTCTTGTGACTCCGCCTCCT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
van der Horst SEM, Cravo J, Woollard A, Teapal J, van den Heuvel S.
C. elegans Runx/CBFβ suppresses POP-1 TCF to convert asymmetric to proliferative division of stem cell-like seam cells.
Development 2019 146(22)  
[ PubMed ID = 31740621 ] [ RRC reference ]

Robinson SB, Refai O, Hardaway JA, Sturgeon S, Popay T, Bermingham DP, Freeman P, Wright J, Blakely RD.
Dopamine-dependent, swimming-induced paralysis arises as a consequence of loss of function mutations in the RUNX transcription factor RNT-1.
PLoS One 2019 14(5) e0216417 
[ PubMed ID = 31083672 ] [ RRC reference ]

Hughes S, Brabin C, Appleford PJ, Woollard A.
CEH-20/Pbx and UNC-62/Meis function upstream of rnt-1/Runx to regulate asymmetric divisions of the C. elegans stem-like seam cells.
Biol Open 2013 2(7) 718-27 
[ PubMed ID = 23862020 ] [ RRC reference ]

Hajduskova M, Jindra M, Herman MA, Asahina M.
The nuclear receptor NHR-25 cooperates with the Wnt/beta-catenin asymmetry pathway to control differentiation of the T seam cell in C. elegans.
J Cell Sci 2009 122(Pt 17) 3051-60 
[ PubMed ID = 19654209 ] [ RRC reference ]

Kagoshima H, Nimmo R, Saad N, Tanaka J, Miwa Y, Mitani S, Kohara Y, Woollard A.
The C. elegans CBFbeta homologue BRO-1 interacts with the Runx factor, RNT-1, to promote stem cell proliferation and self-renewal.
Development 2007 134(21) 3905-15 
[ PubMed ID = 17933794 ] [ RRC reference ]