分離済み変異体

tm1165

Allele Name

tm1165

Balance

Not Required

OutCross

Not Accepted

Sequence Name

ZK180.1

Gene Name

gbb-2

Worm Base

Allele Name

tm1165

Gene Name

gbb-2

Sequence

ZK180.1

Phenotype

homozygous viable. Dr. C.L. Creasy: fertile, normal locomotion, normal egg-laying, solitary social feeding. Dr. J. Kaplan: J. Neurosci 28, 7104 (2008).

Mutation site

9048/9049-9412/9413 (364 bp deletion)

Chromosome

Putative gene structure

complement(join(6639..6663, 6973..7085, 7129..7183, 7537..7627, 7939..8025, 8085..8163, 8573..8674, 9030..9393, 9818..10035, 10343..10417))

Map position

0.41

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TGGTACCATTAGGACTCCTT,IntFwd:AGGACTCCTTTGACTGCATA,ExtRev:CTATTCCAGAGAGCCGGCGA,IntRev:GCCGGCGATGTCTGGAATGA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Tuckowski AM, Beydoun S, Kitto ES, Bhat A, Howington MB, Sridhar A, Bhandari M, Chambers K, Leiser SF.
fmo-4 promotes longevity and stress resistance via ER to mitochondria calcium regulation in C. elegans.
Elife 2025 13
[ PubMed ID = 39951337 ] [ RRC reference ]

Wang Z, Zhang Q, Jiang Y, Zhou J, Tian Y.
ASI-RIM neuronal axis regulates systemic mitochondrial stress response via TGF-β signaling cascade.
Nat Commun 2024 15(1) 8997
[ PubMed ID = 39426950 ] [ RRC reference ]

Cornell R, Cao W, Harradine B, Godini R, Handley A, Pocock R.
Neuro-intestinal acetylcholine signalling regulates the mitochondrial stress response in Caenorhabditis elegans.
Nat Commun 2024 15(1) 6594
[ PubMed ID = 39097618 ] [ RRC reference ]

Jánosi B, Liewald JF, Seidenthal M, Yu SC, Umbach S, Redzovic J, Rentsch D, Alcantara IC, Bergs ACF, Schneider MW, Shao J, Gottschalk A.
RIM and RIM-Binding Protein Localize Synaptic CaV2 Channels to Differentially Regulate Transmission in Neuronal Circuits.
J Neurosci 2024 44(31)
[ PubMed ID = 38951038 ] [ RRC reference ]

Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910
[ PubMed ID = 38783998 ] [ RRC reference ]

Liu J, Zhang P, Zheng Z, Afridi MI, Zhang S, Wan Z, Zhang X, Stingelin L, Wang Y, Tu H.
GABAergic signaling between enteric neurons and intestinal smooth muscle promotes innate immunity and gut defense in Caenorhabditis elegans.
Immunity 2023 56(7) 1515-1532.e9
[ PubMed ID = 37437538 ] [ RRC reference ]

Zheng Z, Zhang X, Liu J, He P, Zhang S, Zhang Y, Gao J, Yang S, Kang N, Afridi MI, Gao S, Chen C, Tu H.
GABAergic synapses suppress intestinal innate immunity via insulin signaling in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2021 118(20)
[ PubMed ID = 33972423 ] [ RRC reference ]

Chun L, Gong J, Yuan F, Zhang B, Liu H, Zheng T, Yu T, Xu XZ, Liu J.
Metabotropic GABA signalling modulates longevity in C. elegans.
Nat Commun 2015 6 8828
[ PubMed ID = 26537867 ] [ RRC reference ]

Han B, Bellemer A, Koelle MR.
An evolutionarily conserved switch in response to GABA affects development and behavior of the locomotor circuit of Caenorhabditis elegans.
Genetics 2015 199(4) 1159-72
[ PubMed ID = 25644702 ] [ RRC reference ]

Hawkins EG, Martin I, Kondo LM, Judy ME, Brings VE, Chan CL, Blackwell GG, Bettinger JC, Davies AG.
A novel cholinergic action of alcohol and the development of tolerance to that effect in Caenorhabditis elegans.
Genetics 2015 199(1) 135-49
[ PubMed ID = 25342716 ] [ RRC reference ]

Schultheis C, Brauner M, Liewald JF, Gottschalk A.
Optogenetic analysis of GABAB receptor signaling in Caenorhabditis elegans motor neurons.
J Neurophysiol 2011 106(2) 817-27
[ PubMed ID = 21613582 ] [ RRC reference ]

Dittman JS, Kaplan JM.
Behavioral impact of neurotransmitter-activated G-protein-coupled receptors: muscarinic and GABAB receptors regulate Caenorhabditis elegans locomotion.
J Neurosci 2008 28(28) 7104-12
[ PubMed ID = 18614679 ] [ RRC reference ]