| Allele Name | tm1156 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | Y66A7A.6 |
| Gene Name | gly-8 |
| Worm Base | Allele Name |
tm1156
|
| Gene Name |
gly-8
|
| Sequence |
Y66A7A.6
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| [Y66A7AR] 15318/15319-[Y66A7AR] 16256/16257 (938 bp deletion) |
| Chromosome | III |
| Putative gene structure | join(14766..14872, 15159..15237, 15293..15396, 15919..16171, 16249..16382, 16429..16587, 16635..16752, 17368..17520, 17566..17724) |
| Map position | 11.36 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:CGATATGTCGGGCGCAACCT,IntRev:CAACCTCGCCTCCACATAGT,ExtFwd:TACAGAATGCGACGCCACGT,IntFwd:CGCCACGTCGTCCTATCGAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Wang Z, Zhang Q, Jiang Y, Zhou J, Tian Y.
ASI-RIM neuronal axis regulates systemic mitochondrial stress response via TGF-β signaling cascade.
Nat Commun 2024 15(1) 8997
[ PubMed ID = 39426950 ]
[ RRC reference ]
|
Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705
[ PubMed ID = 38239833 ]
[ RRC reference ]
|
Tsai HY, Cheng HT, Tsai YT.
Biogenesis of C. elegans spermatogenesis small RNAs is initiated by a zc3h12a-like ribonuclease.
Sci Adv 2022 8(32) eabm0699
[ PubMed ID = 35947655 ]
[ RRC reference ]
|
Liachko NF, Saxton AD, McMillan PJ, Strovas TJ, Keene CD, Bird TD, Kraemer BC.
Genome wide analysis reveals heparan sulfate epimerase modulates TDP-43 proteinopathy.
PLoS Genet 2019 15(12) e1008526
[ PubMed ID = 31834878 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.