分離済み変異体

tm1155

Allele Name

tm1155

Allele Type

通常株

Sequence Name

T22B3.2

Gene Name

alg-3

Worm Base

Allele Name

tm1155

Gene Name

alg-3

Sequence

T22B3.2

Phenotype

homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).

Mutation site

7953/7954-8282/8283 (329 bp deletion)

Chromosome

Putative gene structure

join(7958..8012, 8296..8453, 8503..8675, 8721..9605, 9658..9874, 9921..10251, Z68750.1:110..286, Z68750.1:337..599, Z68750.1:644..768, Z68750.1:813..1310, Z68750.1:1357..1481, Z68750.1:1529..1620)

Map position

5.22

Balancer

Map position of balancer

Sequence of primers

ExtFwd:CGCAATGGTTAGAAGTCGCA,IntFwd:GAGGACAACACGCTATGGAA,ExtRev:CGTACTTCTCGGAGAAGTAG,IntRev:CCGAGCACACAACTTGTCGT

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Toker IA, Lev I, Mor Y, Gurevich Y, Fisher D, Houri-Zeevi L, Antonova O, Doron H, Anava S, Gingold H, Hadany L, Shaham S, Rechavi O.
Transgenerational inheritance of sexual attractiveness via small RNAs enhances evolvability in C. elegans.
Dev Cell 2022 57(3) 298-309.e9
[ PubMed ID = 35134343 ] [ RRC reference ]

Sang Y, Ren J, Aballay A.
The transcription factor HLH-26 controls probiotic-mediated protection against intestinal infection through up-regulation of the Wnt/BAR-1 pathway.
PLoS Biol 2022 20(3) e3001581
[ PubMed ID = 35263319 ] [ RRC reference ]

Nguyen DAH, Phillips CM.
Arginine methylation promotes siRNA-binding specificity for a spermatogenesis-specific isoform of the Argonaute protein CSR-1.
Nat Commun 2021 12(1) 4212
[ PubMed ID = 34244496 ] [ RRC reference ]

Charlesworth AG, Seroussi U, Lehrbach NJ, Renaud MS, Sundby AE, Molnar RI, Lao RX, Willis AR, Woock JR, Aber MJ, Diao AJ, Reinke AW, Ruvkun G, Claycomb JM.
Two isoforms of the essential C. elegans Argonaute CSR-1 differentially regulate sperm and oocyte fertility.
Nucleic Acids Res 2021 49(15) 8836-8865
[ PubMed ID = 34329465 ] [ RRC reference ]

Almeida MV, Dietz S, Redl S, Karaulanov E, Hildebrandt A, Renz C, Ulrich HD, König J, Butter F, Ketting RF.
GTSF-1 is required for formation of a functional RNA-dependent RNA Polymerase complex in Caenorhabditis elegans.
EMBO J 2018 37(12)
[ PubMed ID = 29769402 ] [ RRC reference ]

Zamanian M, Cook DE, Zdraljevic S, Brady SC, Lee D, Lee J, Andersen EC.
Discovery of genomic intervals that underlie nematode responses to benzimidazoles.
PLoS Negl Trop Dis 2018 12(3) e0006368
[ PubMed ID = 29601575 ] [ RRC reference ]

Conine CC, Batista PJ, Gu W, Claycomb JM, Chaves DA, Shirayama M, Mello CC.
Argonautes ALG-3 and ALG-4 are required for spermatogenesis-specific 26G-RNAs and thermotolerant sperm in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2010 107(8) 3588-93
[ PubMed ID = 20133686 ] [ RRC reference ]

Phillips CM, Brown KC, Montgomery BE, Ruvkun G, Montgomery TA.
piRNAs and piRNA-Dependent siRNAs Protect Conserved and Essential C. elegans Genes from Misrouting into the RNAi Pathway.
Dev Cell 2015 34(4) 457-65
[ PubMed ID = 26279487 ] [ RRC reference ]

Campbell AC, Updike DL.
CSR-1 and P granules suppress sperm-specific transcription in the C. elegans germline.
Development 2015 142(10) 1745-55
[ PubMed ID = 25968310 ] [ RRC reference ]

Conine CC, Moresco JJ, Gu W, Shirayama M, Conte D Jr, Yates JR 3rd, Mello CC.
Argonautes promote male fertility and provide a paternal memory of germline gene expression in C. elegans.
Cell 2013 155(7) 1532-44
[ PubMed ID = 24360276 ] [ RRC reference ]

Han T, Manoharan AP, Harkins TT, Bouffard P, Fitzpatrick C, Chu DS, Thierry-Mieg D, Thierry-Mieg J, Kim JK.
26G endo-siRNAs regulate spermatogenic and zygotic gene expression in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2009 106(44) 18674-9
[ PubMed ID = 19846761 ] [ RRC reference ]