| Allele Name | tm1153 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F45E6.2 |
| Gene Name | atf-6 |
| Worm Base | Allele Name |
tm1153
|
| Gene Name |
atf-6
|
| Sequence |
F45E6.2
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 11879/11880-12522/12523 (643 bp deletion) |
| Chromosome | X |
| Putative gene structure | join(10548..10640, 10697..10888, 11181..11456, 11505..11675, 11726..11902, 11951..12190, 12237..12322, 12372..12602, 12835..13051, 13786..13872) |
| Map position | 7.11 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GTGCCCATTCGTGTCATTAT,ExtRev:ACGTCGGTAGTGTGCCCATT,IntFwd:CCGCCGCAATTTGACCAGCT,ExtFwd:TCCTTAATCGTCTTGCCCTC |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Tataridas-Pallas N, Aman Y, Williams R, Chapman H, Cheng KJH, Gomez-Paredes C, Bates GP, Labbadia J. Mitochondrial clearance and increased HSF-1 activity are coupled to promote longevity in fasted Caenorhabditis elegans. iScience 2024 27(6) 109834
[ PubMed ID = 38784016 ]
[ RRC reference ]
|
Guan L, Zhan Z, Yang Y, Miao Y, Huang X, Ding M. Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons. PLoS Genet 2020 16(9) e1008704
[ PubMed ID = 32986702 ]
[ RRC reference ]
|
Waldherr SM, Strovas TJ, Vadset TA, Liachko NF, Kraemer BC. Constitutive XBP-1s-mediated activation of the endoplasmic reticulum unfolded protein response protects against pathological tau. Nat Commun 2019 10(1) 4443
[ PubMed ID = 31570707 ]
[ RRC reference ]
|
Sakaki K, Yoshina S, Shen X, Han J, DeSantis MR, Xiong M, Mitani S, Kaufman RJ. RNA surveillance is required for endoplasmic reticulum homeostasis. Proc Natl Acad Sci U S A 2012 109(21) 8079-84
[ PubMed ID = 22562797 ]
[ RRC reference ]
|
Mao XR, Crowder CM. Protein misfolding induces hypoxic preconditioning via a subset of the unfolded protein response machinery. Mol Cell Biol 2010 30(21) 5033-42
[ PubMed ID = 20733002 ]
[ RRC reference ]
|
|