分離済み変異体

tm1153

Allele Nametm1153
BalanceNot Required
OutCrossNot Accepted
Sequence NameF45E6.2
Gene Nameatf-6
Worm BaseAllele Name tm1153
Gene Name atf-6
Sequence F45E6.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 11879/11880-12522/12523 (643 bp deletion)
ChromosomeX
Putative gene structurejoin(10548..10640, 10697..10888, 11181..11456, 11505..11675, 11726..11902, 11951..12190, 12237..12322, 12372..12602, 12835..13051, 13786..13872)
Map position7.11
Balancer
Map position of balancer
Sequence of primersIntRev:GTGCCCATTCGTGTCATTAT,ExtRev:ACGTCGGTAGTGTGCCCATT,IntFwd:CCGCCGCAATTTGACCAGCT,ExtFwd:TCCTTAATCGTCTTGCCCTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Tataridas-Pallas N, Aman Y, Williams R, Chapman H, Cheng KJH, Gomez-Paredes C, Bates GP, Labbadia J.
Mitochondrial clearance and increased HSF-1 activity are coupled to promote longevity in fasted Caenorhabditis elegans.
iScience 2024 27(6) 109834 
[ PubMed ID = 38784016 ] [ RRC reference ]

Guan L, Zhan Z, Yang Y, Miao Y, Huang X, Ding M.
Alleviating chronic ER stress by p38-Ire1-Xbp1 pathway and insulin-associated autophagy in C. elegans neurons.
PLoS Genet 2020 16(9) e1008704 
[ PubMed ID = 32986702 ] [ RRC reference ]

Waldherr SM, Strovas TJ, Vadset TA, Liachko NF, Kraemer BC.
Constitutive XBP-1s-mediated activation of the endoplasmic reticulum unfolded protein response protects against pathological tau.
Nat Commun 2019 10(1) 4443 
[ PubMed ID = 31570707 ] [ RRC reference ]

Sakaki K, Yoshina S, Shen X, Han J, DeSantis MR, Xiong M, Mitani S, Kaufman RJ.
RNA surveillance is required for endoplasmic reticulum homeostasis.
Proc Natl Acad Sci U S A 2012 109(21) 8079-84 
[ PubMed ID = 22562797 ] [ RRC reference ]

Mao XR, Crowder CM.
Protein misfolding induces hypoxic preconditioning via a subset of the unfolded protein response machinery.
Mol Cell Biol 2010 30(21) 5033-42 
[ PubMed ID = 20733002 ] [ RRC reference ]