Home > 分離済み変異体 > tm1146

分離済み変異体

Allele Name		tm1146
Balance		Not Required
OutCross		Not Accepted
Sequence Name		ZK430.3
Gene Name		sod-5
Worm Base	Allele Name	tm1146
	Gene Name	sod-5
	Sequence	ZK430.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		24926/24927-25701/25702 (775 bp deletion)
Chromosome		II
Putative gene structure		join(24739..24780, 24892..24975, 25564..25722, 25771..25924, 25970..26067)
Map position		-4.69
Balancer
Map position of balancer
Sequence of primers		IntRev:GATCGACGTGGACAACCATG,IntFwd:GCATCTGCCTTGTCGTGGAT,ExtRev:GGCCTTGTCGTCGATTCCCT,ExtFwd:AATGGCGGAAGGATAGCATC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Agrawal S, Babu KR. Systematic optimization of Caenorhabditis elegans cryopreservation. Biochem Biophys Rep 2025 44 102383  [ PubMed ID = 41362646 ] [ RRC reference ] Pu L, Zhao L, Wang J, Deleuze C, Nilsson L, Henriksson J, Laurent P, Chen C. Avoidance of hydrogen sulfide is modulated by external and internal states in Caenorhabditis elegans. Elife 2025 12   [ PubMed ID = 41288154 ] [ RRC reference ] Salcedo-Tacuma D, Asad N, Islam MQ, Anderson R, Smith DM. Hyperactive 20S proteasome enhances proteostasis and ERAD in C. elegans via degradation of intrinsically disordered proteins. Sci Adv 2025 11(41) eadx3014  [ PubMed ID = 41071871 ] [ RRC reference ] Barbosa DJ, Santos IC, Moyisyeyenko T, Mendes C, Sobral AF. C. elegans as a powerful model for neurotoxicity assessment. Neurotoxicology 2025 110 85-110  [ PubMed ID = 40721045 ] [ RRC reference ] Jia Q, Young D, Zhang Q, Sieburth D. Endogenous hydrogen peroxide positively regulates secretion of a gut-derived peptide in neuroendocrine potentiation of the oxidative stress response in Caenorhabditis elegans. Elife 2024 13   [ PubMed ID = 39636673 ] [ RRC reference ] Jia Q, Young D, Zhang Q, Sieburth D. Endogenous hydrogen peroxide positively regulates secretion of a gut-derived peptide in neuroendocrine potentiation of the oxidative stress response in C. elegans. bioRxiv 2024    [ PubMed ID = 39345448 ] [ RRC reference ] Eck RJ, Stair JG, Kraemer BC, Liachko NF. Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Front Neurosci 2023 17 1300705  [ PubMed ID = 38239833 ] [ RRC reference ] Wong CH, Haque MA, Chang HC. Superoxide dismutase SOD-3 regulates redox homeostasis in the intestine. MicroPubl Biol 2023 2023   [ PubMed ID = 38188420 ] [ RRC reference ] Branicky R, Wang Y, Khaki A, Liu JL, Kramer-Drauberg M, Hekimi S. Stimulation of RAS-dependent ROS signaling extends longevity by modulating a developmental program of global gene expression. Sci Adv 2022 8(48) eadc9851  [ PubMed ID = 36449615 ] [ RRC reference ] Zhao L, Fenk LA, Nilsson L, Amin-Wetzel NP, Ramirez-Suarez NJ, de Bono M, Chen C. ROS and cGMP signaling modulate persistent escape from hypoxia in Caenorhabditis elegans. PLoS Biol 2022 20(6) e3001684  [ PubMed ID = 35727855 ] [ RRC reference ] Gaidamakova EK, Sharma A, Matrosova VY, Grichenko O, Volpe RP, Tkavc R, Conze IH, Klimenkova P, Balygina I, Horne WH, Gostinčar C, Chen X, Makarova KS, Shuryak I, Srinivasan C, Jackson-Thompson B, Hoffman BM, Daly MJ. Small-Molecule Mn Antioxidants in Caenorhabditis elegans and Deinococcus radiodurans Supplant MnSOD Enzymes during Aging and Irradiation. mBio 2022 13(1) e0339421  [ PubMed ID = 35012337 ] [ RRC reference ] Chen H, Li R, Zhao F, Luan L, Han T, Li Z. Betulinic acid increases lifespan and stress resistance via insulin/IGF-1 signaling pathway in Caenorhabditis elegans. Front Nutr 2022 9 960239  [ PubMed ID = 35967806 ] [ RRC reference ] Hershberger KA, Rooney JP, Turner EA, Donoghue LJ, Bodhicharla R, Maurer LL, Ryde IT, Kim JJ, Joglekar R, Hibshman JD, Smith LL, Bhatt DP, Ilkayeva OR, Hirschey MD, Meyer JN. Early-life mitochondrial DNA damage results in lifelong deficits in energy production mediated by redox signaling in Caenorhabditis elegans. Redox Biol 2021 43 102000  [ PubMed ID = 33993056 ] [ RRC reference ] Fernando LM, Adeel S, Basar MA, Allen AK, Duttaroy A. In-gel SOD assay reveals SOD-2 is the single active, water-soluble SOD enzyme in C. elegans. Free Radic Res 2021 55(6) 619-624  [ PubMed ID = 34514925 ] [ RRC reference ] Yanase S, Yasuda K, Ishii N. Interaction between the ins/IGF-1 and p38 MAPK signaling pathways in molecular compensation of sod genes and modulation related to intracellular ROS levels in C. elegans. Biochem Biophys Rep 2020 23 100796  [ PubMed ID = 32875124 ] [ RRC reference ] Yanase S, Yasuda K, Ishii N. Interaction between the ins/IGF-1 and p38 MAPK signaling pathways in molecular compensation of sod genes and modulation related to intracellular ROS levels in C. elegans. Biochem Biophys Rep 2020 23 100796  [ PubMed ID = 32875124 ] [ RRC reference ] Kelley CA, De Henau S, Bell L, Dansen TB, Cram EJ. Redox signaling modulates Rho activity and tissue contractility in the Caenorhabditis elegans spermatheca. Mol Biol Cell 2020 31(14) 1486-1497  [ PubMed ID = 32374641 ] [ RRC reference ] Tjahjono E, McAnena AP, Kirienko NV. The evolutionarily conserved ESRE stress response network is activated by ROS and mitochondrial damage. BMC Biol 2020 18(1) 74  [ PubMed ID = 32600387 ] [ RRC reference ] Zhang M, Li Z, Gao D, Gong W, Gao Y, Zhang C. Hydrogen extends Caenorhabditis elegans longevity by reducing reactive oxygen species. PLoS One 2020 15(4) e0231972  [ PubMed ID = 32320994 ] [ RRC reference ] Dues DJ, Andrews EK, Senchuk MM, Van Raamsdonk JM. Resistance to Stress Can Be Experimentally Dissociated From Longevity. J Gerontol A Biol Sci Med Sci 2019 74(8) 1206-1214  [ PubMed ID = 30247515 ] [ RRC reference ]