分離済み変異体

tm1145

Allele Nametm1145
BalanceNot Required
OutCrossNot Accepted
Sequence NameC36A4.8
Gene Namebrc-1
Worm BaseAllele Name tm1145
Gene Name brc-1
Sequence C36A4.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. A. Dernburg: nonHim, normal meiosis. Dr. S. Boulton: EMBO J, 24, 4345-4355 (2005), Dr. S. Boulton: EMBO J, 25, 2178-2188 (2006)
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 33302/33303-33971/33972 (669 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(24651..24899, 25595..25768, 29731..29849, 32650..33031, 33094..33167, 33217..33445, 33902..34247, 34301..34371))
Map position-4.25
Balancer
Map position of balancer
Sequence of primersIntRev:AATATAGGCACCGGCGGGGA,ExtRev:CTCCGTAGCTTGAAGTCTCA,IntFwd:TGTCGCATCGTCGGCATTAA,ExtFwd:TTTCGGTGGCGCCACATGGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fernández-Fernández N, Chacón M, Camino LP, Garcia-Muse T.
Damage-induced phosphorylation of BRC-1/BRD-1 in meiosis preserves germline integrity.
Nucleic Acids Res 2025 53(18)  
[ PubMed ID = 40990247 ] [ RRC reference ]

Yuan H, Odiba AS, Liao G, Zhou Z, Fang W, Jin C, Li S, Liu X, Wang B.
Separation-of-Function Alleles of smc-5 Reveal Domain-Specific Defects and a Conserved Residue Critical for Genome Maintenance.
Biomolecules 2025 15(6)  
[ PubMed ID = 40563397 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Thapa I, Sellin Jeffries MK, Stewart MD.
One of these strains is not like the others: C. elegans DW102 has an altered dependence on brc-1 and brd-1 for regulation of cyp gene transcription.
MicroPubl Biol 2024 2024  
[ PubMed ID = 38894809 ] [ RRC reference ]

Saito TT, Yamamoto K, Minami H, Tsujiue T.
Caenorhabditis elegans brc-1 mutation increases the number of COSA-1 foci in him-8 and zim-2 mutants.
MicroPubl Biol 2024 2024  
[ PubMed ID = 39132054 ] [ RRC reference ]

Bujarrabal-Dueso A, Sendtner G, Meyer DH, Chatzinikolaou G, Stratigi K, Garinis GA, Schumacher B.
The DREAM complex functions as conserved master regulator of somatic DNA-repair capacities.
Nat Struct Mol Biol 2023 30(4) 475-488 
[ PubMed ID = 36959262 ] [ RRC reference ]

Hariri S, Li Q, Engebrecht J.
53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans.
MicroPubl Biol 2023 2023  
[ PubMed ID = 37581122 ] [ RRC reference ]

Wang S, Meyer DH, Schumacher B.
Inheritance of paternal DNA damage by histone-mediated repair restriction.
Nature 2023 613(7943) 365-374 
[ PubMed ID = 36544019 ] [ RRC reference ]

Sang L, Dong R, Liu R, Hao Q, Bai W, Sun J.
Caenorhabditis elegans NHR-14/HNF4α regulates DNA damage-induced apoptosis through cooperating with cep-1/p53.
Cell Commun Signal 2022 20(1) 135 
[ PubMed ID = 36050770 ] [ RRC reference ]

Odiba AS, Ezechukwu CS, Liao G, Li S, Chen Z, Liu X, Fang W, Jin C, Wang B.
Loss of NSE-4 Perturbs Genome Stability and DNA Repair in Caenorhabditis elegans.
Int J Mol Sci 2022 23(13)  
[ PubMed ID = 35806213 ] [ RRC reference ]

Silva N, Castellano-Pozo M, Matsuzaki K, Barroso C, Roman-Trufero M, Craig H, Brooks DR, Isaac RE, Boulton SJ, Martinez-Perez E.
Proline-specific aminopeptidase P prevents replication-associated genome instability.
PLoS Genet 2022 18(1) e1010025 
[ PubMed ID = 35081133 ] [ RRC reference ]

Dello Stritto MR, Bauer B, Barraud P, Jantsch V.
DNA topoisomerase 3 is required for efficient germ cell quality control.
J Cell Biol 2021 220(6)  
[ PubMed ID = 33798260 ] [ RRC reference ]

Sakai Y, Hanafusa H, Shimizu T, Pastuhov SI, Hisamoto N, Matsumoto K.
BRCA1-BARD1 Regulates Axon Regeneration in Concert with the Gqα-DAG Signaling Network.
J Neurosci 2021 41(13) 2842-2853 
[ PubMed ID = 33593852 ] [ RRC reference ]

Sato-Carlton A, Nakamura-Tabuchi C, Li X, Boog H, Lehmer MK, Rosenberg SC, Barroso C, Martinez-Perez E, Corbett KD, Carlton PM.
Phosphoregulation of HORMA domain protein HIM-3 promotes asymmetric synaptonemal complex disassembly in meiotic prophase in Caenorhabditis elegans.
PLoS Genet 2020 16(11) e1008968 
[ PubMed ID = 33175901 ] [ RRC reference ]

Herbette M, Robert V, Bailly A, Gely L, Feil R, Llères D, Palladino F.
A Role for Caenorhabditis elegans COMPASS in Germline Chromatin Organization.
Cells 2020 9(9)  
[ PubMed ID = 32911802 ] [ RRC reference ]

Germoglio M, Valenti A, Gallo I, Forenza C, Santonicola P, Silva N, Adamo A.
In vivo analysis of FANCD2 recruitment at meiotic DNA breaks in Caenorhabditis elegans.
Sci Rep 2020 10(1) 103 
[ PubMed ID = 31919410 ] [ RRC reference ]

Fang EF, Hou Y, Lautrup S, Jensen MB, Yang B, SenGupta T, Caponio D, Khezri R, Demarest TG, Aman Y, Figueroa D, Morevati M, Lee HJ, Kato H, Kassahun H, Lee JH, Filippelli D, Okur MN, Mangerich A, Croteau DL, Maezawa Y, Lyssiotis CA, Tao J, Yokote K, Rusten TE, Mattson MP, Jasper H, Nilsen H, Bohr VA.
NAD+ augmentation restores mitophagy and limits accelerated aging in Werner syndrome.
Nat Commun 2019 10(1) 5284 
[ PubMed ID = 31754102 ] [ RRC reference ]

Chou WY, Lin YC, Lee YH.
Short-term starvation stress at young adult stages enhances meiotic activity of germ cells to maintain spermatogenesis in aged male Caenorhabditis elegans.
Aging Cell 2019 18(3) e12930 
[ PubMed ID = 30816005 ] [ RRC reference ]

Padeken J, Zeller P, Towbin B, Katic I, Kalck V, Methot SP, Gasser SM.
Synergistic lethality between BRCA1 and H3K9me2 loss reflects satellite derepression.
Genes Dev 2019 33(7-8) 436-451 
[ PubMed ID = 30804228 ] [ RRC reference ]

Torgovnick A, Schiavi A, Shaik A, Kassahun H, Maglioni S, Rea SL, Johnson TE, Reinhardt HC, Honnen S, Schumacher B, Nilsen H, Ventura N.
BRCA1 and BARD1 mediate apoptotic resistance but not longevity upon mitochondrial stress in Caenorhabditis elegans.
EMBO Rep 2018 19(12)  
[ PubMed ID = 30366941 ] [ RRC reference ]