Home > 分離済み変異体 > tm1144

分離済み変異体

Allele Name		tm1144
Balance		Not Required
OutCross		Not Accepted
Sequence Name		M03D4.6
Gene Name		M03D4.6
Worm Base	Allele Name	tm1144
	Gene Name	M03D4.6
	Sequence	M03D4.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		37469/37470-TCCAAANCNNNCCCTGGANCTTGGCCCGATGAGGAATNGAATNCCAACCTT-38068/38069 (599 bp deletion + 51 bp insertion)
Chromosome		IV
Putative gene structure		complement(join(35290..35386, 35488..35777, 36123..36377, 36427..36516, 36606..36711, 36957..37201, 37785..38170, 38630..38732))
Map position		3.04
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GATCTGCCTAGTTTTCCCCA,IntFwd:ACTCGTTCCCCTCTCGCGTA,ExtRev:CCAGCCTATTCCATCCTGAT,IntRev:TCCGAGCTGATAATGTCGTA
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Murari E, Meadows D, Cuda N, Mangone M. A comprehensive analysis of 3'UTRs in Caenorhabditis elegans. Nucleic Acids Res 2024 52(13) 7523-7538  [ PubMed ID = 38917330 ] [ RRC reference ] Chen X, Wang K, Mufti FUD, Xu D, Zhu C, Huang X, Zeng C, Jin Q, Huang X, Yan YH, Dong MQ, Feng X, Shi Y, Kennedy S, Guang S. Germ granule compartments coordinate specialized small RNA production. Nat Commun 2024 15(1) 5799  [ PubMed ID = 38987544 ] [ RRC reference ] Weng Y, Murphy CT. Male-specific behavioral and transcriptomic changes in aging C. elegans neurons. iScience 2024 27(6) 109910  [ PubMed ID = 38783998 ] [ RRC reference ] Dube F, Hinas A, Delhomme N, Åbrink M, Svärd S, Tydén E. Transcriptomics of ivermectin response in Caenorhabditis elegans: Integrating abamectin quantitative trait loci and comparison to the Ivermectin-exposed DA1316 strain. PLoS One 2023 18(5) e0285262  [ PubMed ID = 37141255 ] [ RRC reference ] Watts JS, Harrison HF, Omi S, Guenthers Q, Dalelio J, Pujol N, Watts JL. New Strains for Tissue-Specific RNAi Studies in Caenorhabditis elegans. G3 (Bethesda) 2020 10(11) 4167-4176  [ PubMed ID = 32943454 ] [ RRC reference ] Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A. Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans. mBio 2017 8(5)   [ PubMed ID = 29018118 ] [ RRC reference ] Gu SG, Pak J, Guang S, Maniar JM, Kennedy S, Fire A. Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint. Nat Genet 2012 44(2) 157-64  [ PubMed ID = 22231482 ] [ RRC reference ] Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr. Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway. Proc Natl Acad Sci U S A 2010 107(8) 3582-7  [ PubMed ID = 20133583 ] [ RRC reference ] Yigit E, Batista PJ, Bei Y, Pang KM, Chen CC, Tolia NH, Joshua-Tor L, Mitani S, Simard MJ, Mello CC. Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi. Cell 2006 127(4) 747-57  [ PubMed ID = 17110334 ] [ RRC reference ]